Incidental Mutation 'R4303:Ehhadh'
ID322513
Institutional Source Beutler Lab
Gene Symbol Ehhadh
Ensembl Gene ENSMUSG00000022853
Gene Nameenoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase
SynonymsMFP, L-PBE, MFP1, L-bifunctional enzyme, 1300002P22Rik, HD
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location21761287-21787807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21762852 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 463 (K463N)
Ref Sequence ENSEMBL: ENSMUSP00000023559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023559]
Predicted Effect probably damaging
Transcript: ENSMUST00000023559
AA Change: K463N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023559
Gene: ENSMUSG00000022853
AA Change: K463N

DomainStartEndE-ValueType
Pfam:ECH_1 6 203 2.4e-41 PFAM
Pfam:ECH_2 11 254 3.2e-26 PFAM
Pfam:3HCDH_N 297 471 1e-55 PFAM
Pfam:3HCDH 473 577 2.7e-29 PFAM
Pfam:3HCDH 614 710 5.3e-10 PFAM
Meta Mutation Damage Score 0.9326 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme and is one of the four enzymes of the peroxisomal beta-oxidation pathway. The N-terminal region of the encoded protein contains enoyl-CoA hydratase activity while the C-terminal region contains 3-hydroxyacyl-CoA dehydrogenase activity. Defects in this gene are a cause of peroxisomal disorders such as Zellweger syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruption of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehmt2 G A 17: 34,908,748 R901Q possibly damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Ehhadh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Ehhadh APN 16 21762629 missense possibly damaging 0.46
IGL02351:Ehhadh APN 16 21762870 missense probably damaging 1.00
IGL02358:Ehhadh APN 16 21762870 missense probably damaging 1.00
IGL02946:Ehhadh APN 16 21762922 missense probably damaging 1.00
IGL03028:Ehhadh APN 16 21762394 missense probably damaging 1.00
IGL03274:Ehhadh APN 16 21763340 splice site probably benign
IGL03097:Ehhadh UTSW 16 21762770 missense probably benign
R0201:Ehhadh UTSW 16 21773493 critical splice donor site probably null
R0846:Ehhadh UTSW 16 21773497 nonsense probably null
R1194:Ehhadh UTSW 16 21762091 missense probably benign 0.10
R1601:Ehhadh UTSW 16 21766408 missense probably benign
R1739:Ehhadh UTSW 16 21762253 missense probably benign
R1829:Ehhadh UTSW 16 21762178 missense probably damaging 0.99
R4073:Ehhadh UTSW 16 21766507 missense probably benign 0.00
R4120:Ehhadh UTSW 16 21763184 missense probably benign
R4239:Ehhadh UTSW 16 21762688 missense probably damaging 1.00
R4727:Ehhadh UTSW 16 21762431 missense probably benign 0.11
R4838:Ehhadh UTSW 16 21763202 missense possibly damaging 0.45
R5157:Ehhadh UTSW 16 21766511 missense probably benign 0.00
R5284:Ehhadh UTSW 16 21763344 splice site probably null
R5307:Ehhadh UTSW 16 21762692 missense probably benign 0.09
R5346:Ehhadh UTSW 16 21762790 missense probably damaging 1.00
R5872:Ehhadh UTSW 16 21766555 missense probably benign 0.01
R6762:Ehhadh UTSW 16 21762459 missense probably benign 0.01
R6960:Ehhadh UTSW 16 21762278 missense probably benign
R7153:Ehhadh UTSW 16 21766321 missense probably damaging 1.00
R7714:Ehhadh UTSW 16 21766390 missense probably damaging 0.98
R8022:Ehhadh UTSW 16 21777820 missense probably benign 0.01
R8054:Ehhadh UTSW 16 21773493 critical splice donor site probably null
R8221:Ehhadh UTSW 16 21762623 missense possibly damaging 0.77
R8263:Ehhadh UTSW 16 21773545 missense probably damaging 1.00
R8316:Ehhadh UTSW 16 21766303 missense probably benign 0.02
X0018:Ehhadh UTSW 16 21762448 missense probably benign 0.28
Z1177:Ehhadh UTSW 16 21762288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGGACGGTCCAGTAAGGC -3'
(R):5'- ATACCTCAGCACTGGATGTGG -3'

Sequencing Primer
(F):5'- ACATCTAGCCCTGCGAGGTC -3'
(R):5'- CTCAGCACTGGATGTGGATGAC -3'
Posted On2015-06-20