Incidental Mutation 'R4303:Ehmt2'
ID322516
Institutional Source Beutler Lab
Gene Symbol Ehmt2
Ensembl Gene ENSMUSG00000013787
Gene Nameeuchromatic histone lysine N-methyltransferase 2
SynonymsNG36, D17Ertd710e, G9a, KMT1C, Bat8
MMRRC Submission 041090-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4303 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34898469-34914052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34908748 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 901 (R901Q)
Ref Sequence ENSEMBL: ENSMUSP00000109667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013931] [ENSMUST00000078061] [ENSMUST00000097342] [ENSMUST00000114033] [ENSMUST00000124846] [ENSMUST00000137071]
Predicted Effect probably benign
Transcript: ENSMUST00000013931
AA Change: R958Q

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000013931
Gene: ENSMUSG00000013787
AA Change: R958Q

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 604 627 N/A INTRINSIC
ANK 737 766 2.52e-6 SMART
ANK 770 799 1.19e-2 SMART
ANK 803 833 4.71e-6 SMART
ANK 837 866 2.9e-6 SMART
ANK 870 899 1e0 SMART
ANK 903 932 1.53e-5 SMART
PreSET 976 1075 2.44e-40 SMART
SET 1091 1214 4.08e-46 SMART
PostSET 1217 1233 2.84e-1 SMART
low complexity region 1245 1260 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000078061
AA Change: R867Q

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077208
Gene: ENSMUSG00000013787
AA Change: R867Q

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
ANK 646 675 2.52e-6 SMART
ANK 679 708 1.19e-2 SMART
ANK 712 742 4.71e-6 SMART
ANK 746 775 2.9e-6 SMART
ANK 779 808 1e0 SMART
ANK 812 841 1.53e-5 SMART
PreSET 885 984 2.44e-40 SMART
SET 1000 1123 4.08e-46 SMART
PostSET 1126 1142 2.84e-1 SMART
low complexity region 1154 1169 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097342
AA Change: R924Q

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094955
Gene: ENSMUSG00000013787
AA Change: R924Q

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
ANK 703 732 2.52e-6 SMART
ANK 736 765 1.19e-2 SMART
ANK 769 799 4.71e-6 SMART
ANK 803 832 2.9e-6 SMART
ANK 836 865 1e0 SMART
ANK 869 898 1.53e-5 SMART
PreSET 942 1041 2.44e-40 SMART
SET 1057 1180 4.08e-46 SMART
PostSET 1183 1199 2.84e-1 SMART
low complexity region 1211 1226 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114033
AA Change: R901Q

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109667
Gene: ENSMUSG00000013787
AA Change: R901Q

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
ANK 680 709 2.52e-6 SMART
ANK 713 742 1.19e-2 SMART
ANK 746 776 4.71e-6 SMART
ANK 780 809 2.9e-6 SMART
ANK 813 842 1e0 SMART
ANK 846 875 1.53e-5 SMART
PreSET 919 1018 2.44e-40 SMART
SET 1034 1157 4.08e-46 SMART
PostSET 1160 1176 2.84e-1 SMART
low complexity region 1188 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124002
Predicted Effect probably benign
Transcript: ENSMUST00000124846
SMART Domains Protein: ENSMUSP00000121838
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 115 138 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
ANK 258 287 2.52e-6 SMART
ANK 291 320 1.19e-2 SMART
ANK 324 354 4.71e-6 SMART
ANK 358 387 2.9e-6 SMART
ANK 391 420 1e0 SMART
Pfam:Ank 424 442 3.4e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131915
Predicted Effect probably benign
Transcript: ENSMUST00000137071
SMART Domains Protein: ENSMUSP00000134749
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
ANK 23 52 1.19e-2 SMART
ANK 56 86 4.71e-6 SMART
ANK 90 119 2.9e-6 SMART
low complexity region 143 154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150786
Predicted Effect unknown
Transcript: ENSMUST00000172921
AA Change: R176Q
SMART Domains Protein: ENSMUSP00000134089
Gene: ENSMUSG00000013787
AA Change: R176Q

DomainStartEndE-ValueType
ANK 24 53 1.19e-2 SMART
ANK 57 87 4.71e-6 SMART
ANK 89 118 1e0 SMART
ANK 122 151 1.53e-5 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a, adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E9.5-E12.5. Mutant embryos are developmentally delayed. Conditional deletion in germ cells results in infertility and arrest of meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T C 5: 24,401,057 S247P probably damaging Het
Atg4b A G 1: 93,768,262 E41G probably benign Het
Bckdk T C 7: 127,905,330 probably benign Het
Cacna2d1 A G 5: 16,302,248 probably null Het
Chaf1a A G 17: 56,044,068 D16G unknown Het
Defb12 A G 8: 19,112,721 I65T probably benign Het
Dnah7c T C 1: 46,748,578 Y3264H probably damaging Het
Ehhadh C A 16: 21,762,852 K463N probably damaging Het
Ern2 T C 7: 122,177,846 probably null Het
Esp6 A G 17: 40,565,144 T28A possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Gm17333 A C 16: 77,852,879 noncoding transcript Het
Heatr5a T C 12: 51,956,225 T165A probably benign Het
Hoxa5 T C 6: 52,204,260 S31G probably benign Het
Ift80 A G 3: 68,894,174 I744T probably benign Het
Kalrn T C 16: 34,235,391 K853E probably damaging Het
Krt36 A T 11: 100,103,413 D279E possibly damaging Het
Map3k11 T A 19: 5,690,824 V193E probably damaging Het
Mrgpra4 T A 7: 47,980,936 M306L probably benign Het
Myo1a A G 10: 127,713,733 T428A probably benign Het
Nuggc A G 14: 65,611,172 H174R possibly damaging Het
Olfr293 G A 7: 86,663,955 V98M probably benign Het
Olfr389 A T 11: 73,776,838 M163K possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Pik3ca C T 3: 32,439,935 R349* probably null Het
Rfxank T C 8: 70,136,212 D89G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,920 probably benign Het
Serpina1a A G 12: 103,854,675 L348P probably damaging Het
Shank1 A G 7: 44,342,474 Y701C unknown Het
Six4 G T 12: 73,112,540 D207E possibly damaging Het
Slco3a1 G T 7: 74,554,528 D21E probably benign Het
Sox6 C T 7: 115,544,469 probably null Het
Spta1 A G 1: 174,179,852 N216S probably damaging Het
Stard13 T C 5: 151,062,869 N392S possibly damaging Het
Tax1bp1 T C 6: 52,727,278 V81A possibly damaging Het
Trim29 G T 9: 43,311,122 V83L probably damaging Het
Vmn1r90 C T 7: 14,561,570 W201* probably null Het
Wdr31 T A 4: 62,460,389 N7I probably damaging Het
Ypel4 A G 2: 84,736,807 probably benign Het
Zfp39 T C 11: 58,890,017 K640E probably damaging Het
Zfp579 A G 7: 4,993,073 probably benign Het
Zfp974 C A 7: 27,910,232 K689N possibly damaging Het
Other mutations in Ehmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Ehmt2 APN 17 34910815 missense probably damaging 1.00
IGL02398:Ehmt2 APN 17 34908479 missense probably damaging 1.00
IGL02878:Ehmt2 APN 17 34910767 missense probably damaging 1.00
IGL02928:Ehmt2 APN 17 34910822 missense probably damaging 1.00
IGL03117:Ehmt2 APN 17 34906811 missense possibly damaging 0.54
R0630:Ehmt2 UTSW 17 34899842 missense probably benign 0.02
R0778:Ehmt2 UTSW 17 34905418 missense probably damaging 0.99
R0909:Ehmt2 UTSW 17 34906504 missense possibly damaging 0.95
R1402:Ehmt2 UTSW 17 34906781 missense probably benign 0.21
R1402:Ehmt2 UTSW 17 34906781 missense probably benign 0.21
R1405:Ehmt2 UTSW 17 34906577 missense probably benign
R1405:Ehmt2 UTSW 17 34906577 missense probably benign
R1693:Ehmt2 UTSW 17 34906410 missense possibly damaging 0.88
R1855:Ehmt2 UTSW 17 34910776 missense probably damaging 1.00
R2212:Ehmt2 UTSW 17 34899365 missense probably benign
R2275:Ehmt2 UTSW 17 34910715 missense possibly damaging 0.95
R3761:Ehmt2 UTSW 17 34913731 missense probably damaging 0.97
R3827:Ehmt2 UTSW 17 34906765 missense possibly damaging 0.95
R3915:Ehmt2 UTSW 17 34903467 missense probably damaging 0.99
R4529:Ehmt2 UTSW 17 34913731 missense probably damaging 0.97
R4651:Ehmt2 UTSW 17 34913814 missense probably damaging 1.00
R4825:Ehmt2 UTSW 17 34906964 missense probably benign
R5061:Ehmt2 UTSW 17 34899091 nonsense probably null
R5158:Ehmt2 UTSW 17 34911664 missense probably damaging 1.00
R5298:Ehmt2 UTSW 17 34899091 nonsense probably null
R5299:Ehmt2 UTSW 17 34899091 nonsense probably null
R5523:Ehmt2 UTSW 17 34899091 nonsense probably null
R5524:Ehmt2 UTSW 17 34899091 nonsense probably null
R5727:Ehmt2 UTSW 17 34906032 missense possibly damaging 0.75
R5755:Ehmt2 UTSW 17 34908238 missense probably benign 0.05
R5786:Ehmt2 UTSW 17 34910743 missense probably damaging 1.00
R5951:Ehmt2 UTSW 17 34899381 missense probably benign
R6036:Ehmt2 UTSW 17 34899091 nonsense probably null
R6162:Ehmt2 UTSW 17 34899091 nonsense probably null
R6708:Ehmt2 UTSW 17 34899899 nonsense probably null
R6889:Ehmt2 UTSW 17 34912772 missense probably damaging 1.00
R6943:Ehmt2 UTSW 17 34911430 missense probably damaging 1.00
R7470:Ehmt2 UTSW 17 34899396 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ATGCTGTCAACTACCATGGGG -3'
(R):5'- CCCCTAGTGGCAAGATGATTCTAG -3'

Sequencing Primer
(F):5'- AGAGCTACCATGACTGTGTTC -3'
(R):5'- AGCAATTCTCGGGATGTCC -3'
Posted On2015-06-20