Incidental Mutation 'R4304:Wfdc15b'
ID322530
Institutional Source Beutler Lab
Gene Symbol Wfdc15b
Ensembl Gene ENSMUSG00000018211
Gene NameWAP four-disulfide core domain 15B
SynonymsWfdc15, 9230106L14Rik, Swam1
MMRRC Submission 040865-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4304 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164214454-164221660 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to C at 164215468 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1 (M1R)
Ref Sequence ENSEMBL: ENSMUSP00000132507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018355] [ENSMUST00000109376] [ENSMUST00000164567]
Predicted Effect probably null
Transcript: ENSMUST00000018355
AA Change: M1R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018355
Gene: ENSMUSG00000018211
AA Change: M1R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
WAP 32 76 9.87e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109376
AA Change: M1R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105001
Gene: ENSMUSG00000018211
AA Change: M1R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
WAP 32 76 9.87e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164567
AA Change: M1R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132507
Gene: ENSMUSG00000018211
AA Change: M1R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
WAP 32 76 9.87e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,238 Q261* probably null Het
Adam32 A T 8: 24,901,529 M323K probably damaging Het
Arhgap42 A G 9: 9,006,488 S636P probably benign Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Cep152 G A 2: 125,563,723 Q1630* probably null Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Csgalnact1 A T 8: 68,372,642 V400D possibly damaging Het
Fig4 T A 10: 41,256,427 D461V probably benign Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gcfc2 G A 6: 81,943,007 R397Q probably damaging Het
Gm20939 A C 17: 94,877,281 Q452H probably benign Het
Gm5592 A T 7: 41,286,262 M63L probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
H2-M3 T C 17: 37,272,404 M252T probably benign Het
Lsm14a C A 7: 34,357,433 probably null Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Oit1 G A 14: 8,349,324 P209S probably damaging Het
Olfr1240 A T 2: 89,440,198 V27D probably damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rptn C A 3: 93,396,931 H524N probably benign Het
Slc4a11 A T 2: 130,688,138 M240K probably benign Het
Smg1 T C 7: 118,139,518 I3503V probably benign Het
Snx13 A G 12: 35,122,942 K625E probably benign Het
Stk10 T C 11: 32,610,634 V663A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpp1 T A 7: 105,750,309 D84V possibly damaging Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Wfdc15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Wfdc15b APN 2 164215468 start codon destroyed probably null 0.86
R7200:Wfdc15b UTSW 2 164215117 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCGATACTCTGGGCAATAG -3'
(R):5'- CAGGTCCTAGGACATCCAAC -3'

Sequencing Primer
(F):5'- CTGCGGAAGAATATCACAAGATG -3'
(R):5'- GGACATCCAACTGTTAATTCTGCTG -3'
Posted On2015-06-20