Incidental Mutation 'R4304:Prr27'
ID322532
Institutional Source Beutler Lab
Gene Symbol Prr27
Ensembl Gene ENSMUSG00000002240
Gene Nameproline rich 27
Synonyms4930432K09Rik
MMRRC Submission 040865-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4304 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87825686-87846387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87842907 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 126 (H126R)
Ref Sequence ENSEMBL: ENSMUSP00000098617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002310] [ENSMUST00000101056]
Predicted Effect probably benign
Transcript: ENSMUST00000002310
AA Change: H118R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002310
Gene: ENSMUSG00000002240
AA Change: H118R

DomainStartEndE-ValueType
low complexity region 49 57 N/A INTRINSIC
low complexity region 104 130 N/A INTRINSIC
low complexity region 137 153 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101056
AA Change: H126R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000098617
Gene: ENSMUSG00000002240
AA Change: H126R

DomainStartEndE-ValueType
low complexity region 57 65 N/A INTRINSIC
low complexity region 112 138 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197636
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,238 Q261* probably null Het
Adam32 A T 8: 24,901,529 M323K probably damaging Het
Arhgap42 A G 9: 9,006,488 S636P probably benign Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Cep152 G A 2: 125,563,723 Q1630* probably null Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Csgalnact1 A T 8: 68,372,642 V400D possibly damaging Het
Fig4 T A 10: 41,256,427 D461V probably benign Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gcfc2 G A 6: 81,943,007 R397Q probably damaging Het
Gm20939 A C 17: 94,877,281 Q452H probably benign Het
Gm5592 A T 7: 41,286,262 M63L probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
H2-M3 T C 17: 37,272,404 M252T probably benign Het
Lsm14a C A 7: 34,357,433 probably null Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Oit1 G A 14: 8,349,324 P209S probably damaging Het
Olfr1240 A T 2: 89,440,198 V27D probably damaging Het
Rptn C A 3: 93,396,931 H524N probably benign Het
Slc4a11 A T 2: 130,688,138 M240K probably benign Het
Smg1 T C 7: 118,139,518 I3503V probably benign Het
Snx13 A G 12: 35,122,942 K625E probably benign Het
Stk10 T C 11: 32,610,634 V663A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpp1 T A 7: 105,750,309 D84V possibly damaging Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wfdc15b A C 2: 164,215,468 M1R probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Prr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Prr27 APN 5 87843443 missense possibly damaging 0.90
IGL02617:Prr27 APN 5 87842659 missense probably benign 0.00
IGL02995:Prr27 APN 5 87842816 missense probably benign
IGL03270:Prr27 APN 5 87835678 utr 5 prime probably benign
R0531:Prr27 UTSW 5 87842678 missense probably benign 0.02
R0637:Prr27 UTSW 5 87851146 unclassified probably benign
R1498:Prr27 UTSW 5 87850741 unclassified probably benign
R1599:Prr27 UTSW 5 87843225 missense probably benign 0.00
R1744:Prr27 UTSW 5 87843047 missense possibly damaging 0.46
R1980:Prr27 UTSW 5 87843402 missense probably benign 0.03
R4033:Prr27 UTSW 5 87843305 nonsense probably null
R4306:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4307:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4308:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4347:Prr27 UTSW 5 87842672 missense possibly damaging 0.46
R4675:Prr27 UTSW 5 87843241 missense possibly damaging 0.94
R4826:Prr27 UTSW 5 87850966 unclassified probably benign
R4908:Prr27 UTSW 5 87843029 missense probably benign 0.01
R5361:Prr27 UTSW 5 87843344 missense probably damaging 0.96
R5426:Prr27 UTSW 5 87850885 unclassified probably benign
R7268:Prr27 UTSW 5 87843276 missense probably damaging 0.99
R7785:Prr27 UTSW 5 87843272 missense probably benign
R8087:Prr27 UTSW 5 87846309 missense probably benign 0.00
R8250:Prr27 UTSW 5 87842697 missense possibly damaging 0.89
R8270:Prr27 UTSW 5 87846312 missense possibly damaging 0.82
R8375:Prr27 UTSW 5 87842851 nonsense probably null
Z1088:Prr27 UTSW 5 87842646 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCCTATGGAATGATAATTTGCC -3'
(R):5'- TCCAAGTTTGACTGCCTGAG -3'

Sequencing Primer
(F):5'- TGCCTCCTTTTAACACTCAACAAGG -3'
(R):5'- CATAGCAGGAACTGCTAC -3'
Posted On2015-06-20