Incidental Mutation 'R4304:Gm5592'
ID322537
Institutional Source Beutler Lab
Gene Symbol Gm5592
Ensembl Gene ENSMUSG00000072259
Gene Namepredicted gene 5592
Synonyms
MMRRC Submission 040865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4304 (G1)
Quality Score218
Status Not validated
Chromosome7
Chromosomal Location41153841-41290183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41286262 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 63 (M63L)
Ref Sequence ENSEMBL: ENSMUSP00000145899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097044] [ENSMUST00000206490]
Predicted Effect probably benign
Transcript: ENSMUST00000097044
AA Change: M63L

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000094809
Gene: ENSMUSG00000072259
AA Change: M63L

DomainStartEndE-ValueType
Pfam:DUF4629 435 580 6.1e-60 PFAM
low complexity region 607 612 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206040
Predicted Effect probably benign
Transcript: ENSMUST00000206490
AA Change: M63L

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,238 Q261* probably null Het
Adam32 A T 8: 24,901,529 M323K probably damaging Het
Arhgap42 A G 9: 9,006,488 S636P probably benign Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Cep152 G A 2: 125,563,723 Q1630* probably null Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Csgalnact1 A T 8: 68,372,642 V400D possibly damaging Het
Fig4 T A 10: 41,256,427 D461V probably benign Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gcfc2 G A 6: 81,943,007 R397Q probably damaging Het
Gm20939 A C 17: 94,877,281 Q452H probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
H2-M3 T C 17: 37,272,404 M252T probably benign Het
Lsm14a C A 7: 34,357,433 probably null Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Oit1 G A 14: 8,349,324 P209S probably damaging Het
Olfr1240 A T 2: 89,440,198 V27D probably damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rptn C A 3: 93,396,931 H524N probably benign Het
Slc4a11 A T 2: 130,688,138 M240K probably benign Het
Smg1 T C 7: 118,139,518 I3503V probably benign Het
Snx13 A G 12: 35,122,942 K625E probably benign Het
Stk10 T C 11: 32,610,634 V663A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpp1 T A 7: 105,750,309 D84V possibly damaging Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wfdc15b A C 2: 164,215,468 M1R probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Gm5592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Gm5592 APN 7 41289095 missense probably damaging 1.00
IGL01472:Gm5592 APN 7 41286074 splice site probably benign
IGL01718:Gm5592 APN 7 41289193 missense probably damaging 0.99
IGL01981:Gm5592 APN 7 41286371 nonsense probably null
IGL02318:Gm5592 APN 7 41286788 missense probably benign 0.37
IGL02346:Gm5592 APN 7 41289465 missense probably damaging 0.97
IGL02904:Gm5592 APN 7 41288386 missense probably damaging 1.00
I1329:Gm5592 UTSW 7 41286354 nonsense probably null
R0465:Gm5592 UTSW 7 41156057 intron probably benign
R0669:Gm5592 UTSW 7 41155830 intron probably benign
R0675:Gm5592 UTSW 7 41289387 missense possibly damaging 0.81
R1381:Gm5592 UTSW 7 41286172 missense probably benign
R1731:Gm5592 UTSW 7 41288413 missense probably damaging 0.99
R3149:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3150:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3176:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3177:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3276:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3277:Gm5592 UTSW 7 41288380 missense probably benign 0.00
R3623:Gm5592 UTSW 7 41157628 intron probably benign
R3797:Gm5592 UTSW 7 41157835 intron probably benign
R3854:Gm5592 UTSW 7 41157835 intron probably benign
R3856:Gm5592 UTSW 7 41157835 intron probably benign
R4009:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4010:Gm5592 UTSW 7 41286628 missense probably benign 0.05
R4011:Gm5592 UTSW 7 41289510 missense probably benign 0.01
R4127:Gm5592 UTSW 7 41289067 missense probably benign 0.00
R4162:Gm5592 UTSW 7 41217778 intron probably benign
R4289:Gm5592 UTSW 7 41158912 intron probably benign
R4332:Gm5592 UTSW 7 41216118 intron probably benign
R4408:Gm5592 UTSW 7 41286448 missense probably benign 0.04
R4572:Gm5592 UTSW 7 41216159 intron probably benign
R4764:Gm5592 UTSW 7 41216118 intron probably benign
R4822:Gm5592 UTSW 7 41155890 intron probably benign
R4836:Gm5592 UTSW 7 41215534 intron probably benign
R4854:Gm5592 UTSW 7 41217471 intron probably benign
R5032:Gm5592 UTSW 7 41289735 missense probably damaging 1.00
R5075:Gm5592 UTSW 7 41158963 intron probably benign
R5369:Gm5592 UTSW 7 41218211 intron probably benign
R5424:Gm5592 UTSW 7 41155593 intron probably benign
R5700:Gm5592 UTSW 7 41158579 intron probably benign
R5741:Gm5592 UTSW 7 41289201 missense probably benign
R5802:Gm5592 UTSW 7 41219105 intron probably benign
R5945:Gm5592 UTSW 7 41215612 intron probably benign
R6117:Gm5592 UTSW 7 41288464 missense probably benign 0.00
R6324:Gm5592 UTSW 7 41286535 missense probably damaging 0.98
R6449:Gm5592 UTSW 7 41288586 missense probably benign 0.09
R6571:Gm5592 UTSW 7 41288575 missense probably damaging 0.98
R6776:Gm5592 UTSW 7 41289729 missense probably damaging 1.00
R7595:Gm5592 UTSW 7 41286443 missense probably damaging 0.99
R7658:Gm5592 UTSW 7 41288710 missense probably benign 0.03
R7699:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7700:Gm5592 UTSW 7 41286407 missense probably damaging 1.00
R7774:Gm5592 UTSW 7 41289859 missense probably damaging 1.00
R7788:Gm5592 UTSW 7 41286694 missense probably benign 0.01
X0021:Gm5592 UTSW 7 41288508 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTCCCCACAGTAACCTAG -3'
(R):5'- CTCTGGTTTGTCACAGCCAG -3'

Sequencing Primer
(F):5'- AGAAAATTCCCAAAGTTCACCTTTC -3'
(R):5'- TTTGTCACAGCCAGGGAGG -3'
Posted On2015-06-20