Mutagenetix > Incidental Mutations

Incidental Mutation 'R4304:Gm5592'

322537

Institutional Source

Beutler Lab

Gene Symbol

Gm5592

Ensembl Gene

ENSMUSG00000072259

Gene Name

predicted gene 5592

Synonyms

MMRRC Submission

040865-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R4304 (G1)

Quality Score

218

Status

Not validated

Chromosome

Chromosomal Location

41153841-41290183 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 41286262 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 63 (M63L)

Ref Sequence

ENSEMBL: ENSMUSP00000145899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097044] [ENSMUST00000206490]

Predicted Effect

probably benign
Transcript: ENSMUST00000097044
AA Change: M63L

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000094809
Gene: ENSMUSG00000072259
AA Change: M63L

Domain	Start	End	E-Value	Type
Pfam:DUF4629	435	580	6.1e-60	PFAM
low complexity region	607	612	N/A	INTRINSIC
low complexity region	708	725	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206040

Predicted Effect

probably benign
Transcript: ENSMUST00000206490
AA Change: M63L

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	C	T	6: 149,326,238	Q261*	probably null	Het
Adam32	A	T	8: 24,901,529	M323K	probably damaging	Het
Arhgap42	A	G	9: 9,006,488	S636P	probably benign	Het
Arhgef5	C	T	6: 43,279,498	A1180V	probably damaging	Het
Cep152	G	A	2: 125,563,723	Q1630*	probably null	Het
Cfap157	G	A	2: 32,779,042	R350W	probably damaging	Het
Csgalnact1	A	T	8: 68,372,642	V400D	possibly damaging	Het
Fig4	T	A	10: 41,256,427	D461V	probably benign	Het
Frmd4a	C	T	2: 4,333,078	R32C	probably benign	Het
Gcfc2	G	A	6: 81,943,007	R397Q	probably damaging	Het
Gm20939	A	C	17: 94,877,281	Q452H	probably benign	Het
Gm7173	C	G	X: 79,498,029	K469N	probably damaging	Het
H2-M3	T	C	17: 37,272,404	M252T	probably benign	Het
Lsm14a	C	A	7: 34,357,433		probably null	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Npc1	C	T	18: 12,210,527	A470T	possibly damaging	Het
Oit1	G	A	14: 8,349,324	P209S	probably damaging	Het
Olfr1240	A	T	2: 89,440,198	V27D	probably damaging	Het
Prr27	A	G	5: 87,842,907	H126R	probably benign	Het
Rptn	C	A	3: 93,396,931	H524N	probably benign	Het
Slc4a11	A	T	2: 130,688,138	M240K	probably benign	Het
Smg1	T	C	7: 118,139,518	I3503V	probably benign	Het
Snx13	A	G	12: 35,122,942	K625E	probably benign	Het
Stk10	T	C	11: 32,610,634	V663A	probably damaging	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Tpp1	T	A	7: 105,750,309	D84V	possibly damaging	Het
Vmn1r238	T	A	18: 3,123,040	R125*	probably null	Het
Vmn2r12	A	G	5: 109,086,006	L780P	probably damaging	Het
Wfdc15b	A	C	2: 164,215,468	M1R	probably null	Het
Wnk2	C	T	13: 49,090,837	D508N	probably damaging	Het

Other mutations in Gm5592

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Gm5592	APN	7	41289095	missense	probably damaging	1.00
IGL01472:Gm5592	APN	7	41286074	splice site	probably benign
IGL01718:Gm5592	APN	7	41289193	missense	probably damaging	0.99
IGL01981:Gm5592	APN	7	41286371	nonsense	probably null
IGL02318:Gm5592	APN	7	41286788	missense	probably benign	0.37
IGL02346:Gm5592	APN	7	41289465	missense	probably damaging	0.97
IGL02904:Gm5592	APN	7	41288386	missense	probably damaging	1.00
I1329:Gm5592	UTSW	7	41286354	nonsense	probably null
R0465:Gm5592	UTSW	7	41156057	intron	probably benign
R0669:Gm5592	UTSW	7	41155830	intron	probably benign
R0675:Gm5592	UTSW	7	41289387	missense	possibly damaging	0.81
R1381:Gm5592	UTSW	7	41286172	missense	probably benign
R1731:Gm5592	UTSW	7	41288413	missense	probably damaging	0.99
R3149:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3150:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3176:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3177:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3276:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3277:Gm5592	UTSW	7	41288380	missense	probably benign	0.00
R3623:Gm5592	UTSW	7	41157628	intron	probably benign
R3797:Gm5592	UTSW	7	41157835	intron	probably benign
R3854:Gm5592	UTSW	7	41157835	intron	probably benign
R3856:Gm5592	UTSW	7	41157835	intron	probably benign
R4009:Gm5592	UTSW	7	41289510	missense	probably benign	0.01
R4010:Gm5592	UTSW	7	41286628	missense	probably benign	0.05
R4011:Gm5592	UTSW	7	41289510	missense	probably benign	0.01
R4127:Gm5592	UTSW	7	41289067	missense	probably benign	0.00
R4162:Gm5592	UTSW	7	41217778	intron	probably benign
R4289:Gm5592	UTSW	7	41158912	intron	probably benign
R4332:Gm5592	UTSW	7	41216118	intron	probably benign
R4408:Gm5592	UTSW	7	41286448	missense	probably benign	0.04
R4572:Gm5592	UTSW	7	41216159	intron	probably benign
R4764:Gm5592	UTSW	7	41216118	intron	probably benign
R4822:Gm5592	UTSW	7	41155890	intron	probably benign
R4836:Gm5592	UTSW	7	41215534	intron	probably benign
R4854:Gm5592	UTSW	7	41217471	intron	probably benign
R5032:Gm5592	UTSW	7	41289735	missense	probably damaging	1.00
R5075:Gm5592	UTSW	7	41158963	intron	probably benign
R5369:Gm5592	UTSW	7	41218211	intron	probably benign
R5424:Gm5592	UTSW	7	41155593	intron	probably benign
R5700:Gm5592	UTSW	7	41158579	intron	probably benign
R5741:Gm5592	UTSW	7	41289201	missense	probably benign
R5802:Gm5592	UTSW	7	41219105	intron	probably benign
R5945:Gm5592	UTSW	7	41215612	intron	probably benign
R6117:Gm5592	UTSW	7	41288464	missense	probably benign	0.00
R6324:Gm5592	UTSW	7	41286535	missense	probably damaging	0.98
R6449:Gm5592	UTSW	7	41288586	missense	probably benign	0.09
R6571:Gm5592	UTSW	7	41288575	missense	probably damaging	0.98
R6776:Gm5592	UTSW	7	41289729	missense	probably damaging	1.00
R7595:Gm5592	UTSW	7	41286443	missense	probably damaging	0.99
R7658:Gm5592	UTSW	7	41288710	missense	probably benign	0.03
R7699:Gm5592	UTSW	7	41286407	missense	probably damaging	1.00
R7700:Gm5592	UTSW	7	41286407	missense	probably damaging	1.00
R7774:Gm5592	UTSW	7	41289859	missense	probably damaging	1.00
R7788:Gm5592	UTSW	7	41286694	missense	probably benign	0.01
R7890:Gm5592	UTSW	7	41286759	missense	probably damaging	1.00
R8070:Gm5592	UTSW	7	41286463	missense	possibly damaging	0.76
R8417:Gm5592	UTSW	7	41288551	missense	probably benign	0.38
X0021:Gm5592	UTSW	7	41288508	missense	probably benign	0.01
Z1176:Gm5592	UTSW	7	41286317	missense	probably damaging	1.00
Z1176:Gm5592	UTSW	7	41286319	missense	possibly damaging	0.94
Z1176:Gm5592	UTSW	7	41288681	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCTCCCCACAGTAACCTAG -3'
(R):5'- CTCTGGTTTGTCACAGCCAG -3'

Sequencing Primer
(F):5'- AGAAAATTCCCAAAGTTCACCTTTC -3'
(R):5'- TTTGTCACAGCCAGGGAGG -3'

Posted On

2015-06-20