Incidental Mutation 'R4304:Tpp1'
ID322538
Institutional Source Beutler Lab
Gene Symbol Tpp1
Ensembl Gene ENSMUSG00000030894
Gene Nametripeptidyl peptidase I
SynonymsCln2
MMRRC Submission 040865-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4304 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105744811-105752235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105750309 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 84 (D84V)
Ref Sequence ENSEMBL: ENSMUSP00000033184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033184] [ENSMUST00000078482] [ENSMUST00000210066]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033184
AA Change: D84V

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894
AA Change: D84V

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078482
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210018
Predicted Effect silent
Transcript: ENSMUST00000210066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211659
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysosomal serine protease that cleaves N-terminal tripeptides from protein substrates. The encoded preproprotein undergoes autocatalytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit a progressive neurodegeneration and a greatly shortened lifespan. At the cellular level, mice lacking the encoded protein exhibit accumulation of autofluorescent lipopigments. Mutations in the human ortholog of this gene cause classical late-infantile neuronal ceroid lipofuscinosis. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted mutations exhibit progressive motor defects, reduced lifespan, and respiratory difficulty. One mutation also shows extensive neuronal degeneration and an accumulation of lysosomal storage material. Mice homozygous for a different allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,238 Q261* probably null Het
Adam32 A T 8: 24,901,529 M323K probably damaging Het
Arhgap42 A G 9: 9,006,488 S636P probably benign Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Cep152 G A 2: 125,563,723 Q1630* probably null Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Csgalnact1 A T 8: 68,372,642 V400D possibly damaging Het
Fig4 T A 10: 41,256,427 D461V probably benign Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gcfc2 G A 6: 81,943,007 R397Q probably damaging Het
Gm20939 A C 17: 94,877,281 Q452H probably benign Het
Gm5592 A T 7: 41,286,262 M63L probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
H2-M3 T C 17: 37,272,404 M252T probably benign Het
Lsm14a C A 7: 34,357,433 probably null Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Oit1 G A 14: 8,349,324 P209S probably damaging Het
Olfr1240 A T 2: 89,440,198 V27D probably damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rptn C A 3: 93,396,931 H524N probably benign Het
Slc4a11 A T 2: 130,688,138 M240K probably benign Het
Smg1 T C 7: 118,139,518 I3503V probably benign Het
Snx13 A G 12: 35,122,942 K625E probably benign Het
Stk10 T C 11: 32,610,634 V663A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wfdc15b A C 2: 164,215,468 M1R probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Tpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Tpp1 APN 7 105749053 missense probably damaging 1.00
IGL01520:Tpp1 APN 7 105747729 missense probably benign 0.32
IGL01796:Tpp1 APN 7 105747650 unclassified probably benign
IGL01797:Tpp1 APN 7 105749252 missense probably benign 0.07
IGL01923:Tpp1 APN 7 105751650 missense probably benign 0.34
IGL02400:Tpp1 APN 7 105747031 missense possibly damaging 0.91
IGL02411:Tpp1 APN 7 105749619 missense probably damaging 1.00
IGL02423:Tpp1 APN 7 105749700 missense probably damaging 1.00
IGL02672:Tpp1 APN 7 105746961 missense probably benign
IGL03180:Tpp1 APN 7 105746649 missense probably benign
R0709:Tpp1 UTSW 7 105749607 missense probably benign 0.19
R0711:Tpp1 UTSW 7 105749419 missense probably damaging 1.00
R1222:Tpp1 UTSW 7 105746741 missense probably benign 0.05
R1673:Tpp1 UTSW 7 105747673 missense probably damaging 0.99
R1799:Tpp1 UTSW 7 105750308 missense probably benign 0.00
R1822:Tpp1 UTSW 7 105749647 missense probably benign
R1984:Tpp1 UTSW 7 105751698 missense probably benign 0.04
R2109:Tpp1 UTSW 7 105749970 missense probably damaging 1.00
R4618:Tpp1 UTSW 7 105751706 missense probably benign 0.05
R4746:Tpp1 UTSW 7 105748951 missense probably damaging 1.00
R4764:Tpp1 UTSW 7 105749251 missense probably damaging 1.00
R4837:Tpp1 UTSW 7 105746649 missense probably benign
R4855:Tpp1 UTSW 7 105746723 missense probably benign
R5015:Tpp1 UTSW 7 105752025 unclassified probably benign
R5677:Tpp1 UTSW 7 105747536 missense probably damaging 1.00
R5916:Tpp1 UTSW 7 105749380 missense probably damaging 0.97
R6149:Tpp1 UTSW 7 105747727 missense probably benign 0.00
R6291:Tpp1 UTSW 7 105747016 missense probably benign 0.05
R6422:Tpp1 UTSW 7 105746956 missense probably benign 0.01
R6671:Tpp1 UTSW 7 105749607 missense probably benign 0.19
R6841:Tpp1 UTSW 7 105748964 missense probably damaging 0.96
R6851:Tpp1 UTSW 7 105749712 missense probably damaging 1.00
R7022:Tpp1 UTSW 7 105748922 missense probably damaging 1.00
R7106:Tpp1 UTSW 7 105749911 missense possibly damaging 0.67
R7260:Tpp1 UTSW 7 105747497 missense probably benign 0.00
R7485:Tpp1 UTSW 7 105749544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGCACGCTTTAAACTC -3'
(R):5'- ATGACGTTTCATGTCTCTCGAGC -3'

Sequencing Primer
(F):5'- ACGCTTTAAACTCCCCCAATTGG -3'
(R):5'- GTTTCATGTCTCTCGAGCCTTTTC -3'
Posted On2015-06-20