Incidental Mutation 'R0001:Clk4'
ID32254
Institutional Source Beutler Lab
Gene Symbol Clk4
Ensembl Gene ENSMUSG00000020385
Gene NameCDC like kinase 4
Synonyms
MMRRC Submission 038297-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.708) question?
Stock #R0001 (G1)
Quality Score222
Status Validated
Chromosome11
Chromosomal Location51261730-51281766 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 51268765 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093132] [ENSMUST00000109111] [ENSMUST00000109113] [ENSMUST00000126131] [ENSMUST00000130641] [ENSMUST00000148053] [ENSMUST00000153414]
Predicted Effect probably benign
Transcript: ENSMUST00000093132
SMART Domains Protein: ENSMUSP00000090820
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
S_TKc 159 475 1.58e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109111
SMART Domains Protein: ENSMUSP00000104739
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 225 3.3e-20 PFAM
Pfam:Pkinase 1 295 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109113
SMART Domains Protein: ENSMUSP00000104741
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 225 3.3e-20 PFAM
Pfam:Pkinase 1 295 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126131
SMART Domains Protein: ENSMUSP00000118972
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130641
SMART Domains Protein: ENSMUSP00000123133
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 105 122 N/A INTRINSIC
low complexity region 126 141 N/A INTRINSIC
PDB:2VAG|A 149 182 2e-14 PDB
SCOP:d1howa_ 149 182 2e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146776
Predicted Effect probably benign
Transcript: ENSMUST00000148053
SMART Domains Protein: ENSMUSP00000120822
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148467
Predicted Effect probably benign
Transcript: ENSMUST00000153414
SMART Domains Protein: ENSMUSP00000115894
Gene: ENSMUSG00000020385

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177296
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDC2-like protein kinase (CLK) family. This protein kinase can interact with and phosphorylate the serine- and arginine-rich (SR) proteins, which are known to play an important role in the formation of spliceosomes, and thus may be involved in the regulation of alternative splicing. Studies in the Israeli sand rat Psammomys obesus suggested that the ubiquitin-like 5 (UBL5/BEACON), a highly conserved ubiquitin-like protein, may interact with and regulate the activity of this kinase. Multiple alternatively spliced transcript variants have been observed, but the full-length natures of which have not yet been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik G A 19: 58,789,171 A61V probably damaging Het
2900092C05Rik T A 7: 12,554,607 probably benign Het
A4galt A G 15: 83,228,289 F98L probably benign Het
Abca4 T G 3: 122,081,011 probably benign Het
Acacb C T 5: 114,204,833 probably benign Het
Agbl1 A T 7: 76,419,863 H367L probably damaging Het
Apoa4 C A 9: 46,242,892 Q264K probably benign Het
Camsap2 A T 1: 136,282,888 probably benign Het
Cdan1 C A 2: 120,723,751 R939L probably benign Het
Ceacam18 G A 7: 43,636,876 V58I possibly damaging Het
Ciita A T 16: 10,514,433 probably benign Het
Cntnap2 T C 6: 46,530,171 D215G probably benign Het
Col11a2 T C 17: 34,061,612 S1218P probably benign Het
Col20a1 T C 2: 180,984,412 probably benign Het
Ctsb A G 14: 63,135,622 E76G probably benign Het
Ctu2 T C 8: 122,478,920 C161R probably benign Het
Dhx29 T C 13: 112,964,556 L1211P probably damaging Het
Dhx9 G T 1: 153,462,636 T759K probably damaging Het
Dmxl1 T C 18: 49,888,897 probably benign Het
Dpysl3 C T 18: 43,358,375 E226K possibly damaging Het
Eif2d A T 1: 131,168,127 K453* probably null Het
Epha7 T C 4: 28,961,279 probably benign Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fat3 T C 9: 16,377,873 D118G probably damaging Het
Foxn4 T A 5: 114,260,870 Q159L probably damaging Het
Frs2 G T 10: 117,074,876 H194N possibly damaging Het
Fut8 A T 12: 77,475,315 *576L probably null Het
Galns T C 8: 122,595,883 probably benign Het
Gamt G A 10: 80,259,061 probably benign Het
Gpn1 T A 5: 31,495,617 probably benign Het
Ipcef1 G T 10: 6,900,600 H330Q probably damaging Het
Itga4 A C 2: 79,326,587 Y1024S probably damaging Het
Jak2 A G 19: 29,282,387 I229V probably benign Het
Katnal1 A G 5: 148,921,275 S42P probably damaging Het
Kcnu1 A T 8: 25,859,270 D142V probably damaging Het
Lig3 C T 11: 82,790,591 R470W probably damaging Het
Mgat4c A G 10: 102,388,956 S344G probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 C T 12: 57,460,839 probably benign Het
Mki67 C T 7: 135,699,172 V1378M probably damaging Het
Mki67 T A 7: 135,701,019 D762V probably damaging Het
Mmp9 A G 2: 164,948,383 T43A probably benign Het
Muc6 T C 7: 141,641,574 T1316A possibly damaging Het
Naip5 A G 13: 100,214,650 probably null Het
Naip5 C A 13: 100,223,114 S538I probably benign Het
Nek3 A T 8: 22,158,612 probably benign Het
Nlrp1b A G 11: 71,161,759 S948P probably damaging Het
Nyap2 A T 1: 81,192,107 H193L probably benign Het
Olfr1413 A G 1: 92,573,461 K97E possibly damaging Het
Olfr648 T A 7: 104,179,473 K312* probably null Het
Patl2 G A 2: 122,125,710 probably benign Het
Pcdhb11 A T 18: 37,423,989 R791W probably benign Het
Pkd1l3 C A 8: 109,628,633 probably benign Het
Pkn2 A T 3: 142,828,988 V73D probably benign Het
Pknox1 A T 17: 31,599,636 H281L probably damaging Het
Polr3a A G 14: 24,452,189 probably benign Het
Prss38 A G 11: 59,373,180 probably benign Het
Rad54l2 A G 9: 106,708,217 F783S probably damaging Het
Rbm5 T C 9: 107,742,424 R125G probably damaging Het
Rnpep A G 1: 135,272,485 probably benign Het
Slc1a5 T A 7: 16,793,637 probably null Het
Slc22a4 G A 11: 54,028,003 probably benign Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Svep1 G A 4: 58,066,460 T3208I possibly damaging Het
Tgm5 G T 2: 121,077,646 D16E probably damaging Het
Tpp2 A G 1: 43,971,726 N558D probably benign Het
Trappc9 A T 15: 72,963,662 L507Q probably damaging Het
Trpm3 A T 19: 22,715,331 Q262L possibly damaging Het
Ttn A G 2: 76,776,972 probably benign Het
Ttn G A 2: 76,832,089 probably benign Het
Ubr4 T A 4: 139,451,788 L3316Q probably damaging Het
Uckl1 T A 2: 181,574,655 Y136F probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps39 A G 2: 120,318,053 V870A probably benign Het
Zdhhc25 A G 15: 88,600,909 D149G probably benign Het
Zfp648 C T 1: 154,205,286 T397M probably damaging Het
Zic2 C A 14: 122,478,957 T435K probably damaging Het
Other mutations in Clk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Clk4 APN 11 51281172 nonsense probably null
B6819:Clk4 UTSW 11 51275766 unclassified probably benign
K7894:Clk4 UTSW 11 51275766 unclassified probably benign
R0466:Clk4 UTSW 11 51267328 missense possibly damaging 0.59
R0692:Clk4 UTSW 11 51281328 nonsense probably null
R0719:Clk4 UTSW 11 51275493 nonsense probably null
R0723:Clk4 UTSW 11 51275493 nonsense probably null
R1277:Clk4 UTSW 11 51267189 missense probably benign
R1714:Clk4 UTSW 11 51280418 missense probably damaging 1.00
R4804:Clk4 UTSW 11 51281323 missense probably damaging 1.00
R5141:Clk4 UTSW 11 51275771 missense possibly damaging 0.79
R5399:Clk4 UTSW 11 51275257 missense probably damaging 1.00
R6182:Clk4 UTSW 11 51268182 missense possibly damaging 0.66
R6274:Clk4 UTSW 11 51271921 missense possibly damaging 0.69
R6480:Clk4 UTSW 11 51270546 nonsense probably null
R6759:Clk4 UTSW 11 51275574 missense possibly damaging 0.95
R6843:Clk4 UTSW 11 51276249 critical splice donor site probably null
R7138:Clk4 UTSW 11 51277932 missense probably damaging 1.00
R7186:Clk4 UTSW 11 51268780 missense probably benign 0.00
R7235:Clk4 UTSW 11 51276185 missense probably damaging 0.98
R7687:Clk4 UTSW 11 51281398 missense probably benign 0.02
R7842:Clk4 UTSW 11 51281129 missense probably benign 0.00
R8073:Clk4 UTSW 11 51277889 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GGTGCTGGATAAGGTTATGGCAAGAT -3'
(R):5'- GCTACTGCCAAAAGACAAATCAGGAGAA -3'

Sequencing Primer
(F):5'- GTTATGGCAAGATTCAGTAACCAGAC -3'
(R):5'- CAGGTTAGGAAAACCATTTAAAACAG -3'
Posted On2013-05-09