Mutagenetix > Incidental Mutations

Incidental Mutation 'R4304:Csgalnact1'

322540

Institutional Source

Beutler Lab

Gene Symbol

Csgalnact1

Ensembl Gene

ENSMUSG00000036356

Gene Name

chondroitin sulfate N-acetylgalactosaminyltransferase 1

Synonyms

CSGalNAcT-1, 4732435N03Rik

MMRRC Submission

040865-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R4304 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

68356781-68735146 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 68372642 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 400 (V400D)

Ref Sequence

ENSEMBL: ENSMUSP00000119817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078350
AA Change: V400D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356
AA Change: V400D

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	55	505	3.5e-85	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.2e-10	PFAM
Pfam:Glyco_transf_7C	409	478	1.7e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124929

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130214
AA Change: V400D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356
AA Change: V400D

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	71	505	1.1e-59	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.6e-10	PFAM
Pfam:Glyco_transf_7C	405	478	3.4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139265

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	C	T	6: 149,326,238	Q261*	probably null	Het
Adam32	A	T	8: 24,901,529	M323K	probably damaging	Het
Arhgap42	A	G	9: 9,006,488	S636P	probably benign	Het
Arhgef5	C	T	6: 43,279,498	A1180V	probably damaging	Het
Cep152	G	A	2: 125,563,723	Q1630*	probably null	Het
Cfap157	G	A	2: 32,779,042	R350W	probably damaging	Het
Fig4	T	A	10: 41,256,427	D461V	probably benign	Het
Frmd4a	C	T	2: 4,333,078	R32C	probably benign	Het
Gcfc2	G	A	6: 81,943,007	R397Q	probably damaging	Het
Gm20939	A	C	17: 94,877,281	Q452H	probably benign	Het
Gm5592	A	T	7: 41,286,262	M63L	probably benign	Het
Gm7173	C	G	X: 79,498,029	K469N	probably damaging	Het
H2-M3	T	C	17: 37,272,404	M252T	probably benign	Het
Lsm14a	C	A	7: 34,357,433		probably null	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Npc1	C	T	18: 12,210,527	A470T	possibly damaging	Het
Oit1	G	A	14: 8,349,324	P209S	probably damaging	Het
Olfr1240	A	T	2: 89,440,198	V27D	probably damaging	Het
Prr27	A	G	5: 87,842,907	H126R	probably benign	Het
Rptn	C	A	3: 93,396,931	H524N	probably benign	Het
Slc4a11	A	T	2: 130,688,138	M240K	probably benign	Het
Smg1	T	C	7: 118,139,518	I3503V	probably benign	Het
Snx13	A	G	12: 35,122,942	K625E	probably benign	Het
Stk10	T	C	11: 32,610,634	V663A	probably damaging	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Tpp1	T	A	7: 105,750,309	D84V	possibly damaging	Het
Vmn1r238	T	A	18: 3,123,040	R125*	probably null	Het
Vmn2r12	A	G	5: 109,086,006	L780P	probably damaging	Het
Wfdc15b	A	C	2: 164,215,468	M1R	probably null	Het
Wnk2	C	T	13: 49,090,837	D508N	probably damaging	Het

Other mutations in Csgalnact1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02015:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02025:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02037:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02059:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02074:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02079:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02080:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02094:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02127:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02128:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02157:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02158:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02197:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02201:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02206:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02207:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02214:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02215:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02229:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02243:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02247:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02248:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02250:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02389:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02394:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02397:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02398:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02400:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02404:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02405:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02406:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02420:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02425:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02428:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02436:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02437:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02438:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02468:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02470:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02472:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02473:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02474:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02475:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02510:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02529:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02530:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02531:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02533:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02543:Csgalnact1	APN	8	68461068	missense	probably damaging	1.00
IGL02620:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02625:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02671:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02674:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02683:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02685:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02686:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02697:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02698:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02741:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02985:Csgalnact1	APN	8	68461043	missense	probably benign	0.02
R0173:Csgalnact1	UTSW	8	68461029	missense	probably damaging	1.00
R1594:Csgalnact1	UTSW	8	68358632	missense	probably damaging	1.00
R1655:Csgalnact1	UTSW	8	68373689	missense	possibly damaging	0.89
R1873:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R1955:Csgalnact1	UTSW	8	68372667	missense	probably benign
R2421:Csgalnact1	UTSW	8	68461508	missense	probably benign	0.42
R3195:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3196:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3951:Csgalnact1	UTSW	8	68461262	missense	probably benign
R4989:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5133:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5134:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5503:Csgalnact1	UTSW	8	68461473	missense	probably damaging	0.98
R5812:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R6143:Csgalnact1	UTSW	8	68373550	missense	probably damaging	1.00
R6387:Csgalnact1	UTSW	8	68358713	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461109	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461110	missense	probably damaging	1.00
R7023:Csgalnact1	UTSW	8	68358429	missense	probably benign
R8318:Csgalnact1	UTSW	8	68461133	missense	probably damaging	1.00
R8446:Csgalnact1	UTSW	8	68461091	missense	probably damaging	0.99
R8519:Csgalnact1	UTSW	8	68401453	missense	possibly damaging	0.65
Z1088:Csgalnact1	UTSW	8	68401330	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCGTTGAATCAACACGACAC -3'
(R):5'- CTTCTGAGATCTAGCCTAGACCTG -3'

Sequencing Primer
(F):5'- GTTGAATCAACACGACACTTGAAG -3'
(R):5'- TGAGATCTAGCCTAGACCTGAATGAC -3'

Posted On

2015-06-20