Incidental Mutation 'R4304:Arhgap42'
ID322542
Institutional Source Beutler Lab
Gene Symbol Arhgap42
Ensembl Gene ENSMUSG00000050730
Gene NameRho GTPase activating protein 42
Synonyms9030420J04Rik
MMRRC Submission 040865-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R4304 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location8994329-9239101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9006488 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 636 (S636P)
Ref Sequence ENSEMBL: ENSMUSP00000091419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093893]
Predicted Effect probably benign
Transcript: ENSMUST00000093893
AA Change: S636P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091419
Gene: ENSMUSG00000050730
AA Change: S636P

DomainStartEndE-ValueType
Pfam:BAR_3 6 132 4.4e-36 PFAM
Pfam:BAR_3 125 215 8.9e-29 PFAM
PH 232 342 5.5e-8 SMART
RhoGAP 358 535 1.4e-55 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 599 616 N/A INTRINSIC
Blast:RhoGAP 617 691 2e-37 BLAST
low complexity region 692 711 N/A INTRINSIC
SH3 786 840 7.4e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182617
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit hypertension and increased vascular smooth muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,238 Q261* probably null Het
Adam32 A T 8: 24,901,529 M323K probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Cep152 G A 2: 125,563,723 Q1630* probably null Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Csgalnact1 A T 8: 68,372,642 V400D possibly damaging Het
Fig4 T A 10: 41,256,427 D461V probably benign Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gcfc2 G A 6: 81,943,007 R397Q probably damaging Het
Gm20939 A C 17: 94,877,281 Q452H probably benign Het
Gm5592 A T 7: 41,286,262 M63L probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
H2-M3 T C 17: 37,272,404 M252T probably benign Het
Lsm14a C A 7: 34,357,433 probably null Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Oit1 G A 14: 8,349,324 P209S probably damaging Het
Olfr1240 A T 2: 89,440,198 V27D probably damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rptn C A 3: 93,396,931 H524N probably benign Het
Slc4a11 A T 2: 130,688,138 M240K probably benign Het
Smg1 T C 7: 118,139,518 I3503V probably benign Het
Snx13 A G 12: 35,122,942 K625E probably benign Het
Stk10 T C 11: 32,610,634 V663A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpp1 T A 7: 105,750,309 D84V possibly damaging Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wfdc15b A C 2: 164,215,468 M1R probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Arhgap42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Arhgap42 APN 9 9006343 missense probably damaging 1.00
IGL00576:Arhgap42 APN 9 8997620 nonsense probably null
IGL01693:Arhgap42 APN 9 9006506 missense probably damaging 1.00
IGL01724:Arhgap42 APN 9 8998253 splice site probably benign
IGL02142:Arhgap42 APN 9 9155359 missense probably damaging 1.00
IGL02378:Arhgap42 APN 9 9035583 missense possibly damaging 0.94
IGL02932:Arhgap42 APN 9 9115708 missense probably damaging 0.98
IGL02992:Arhgap42 APN 9 8998248 splice site probably benign
IGL03149:Arhgap42 APN 9 9008084 missense possibly damaging 0.71
R0096:Arhgap42 UTSW 9 9009313 missense probably damaging 1.00
R0096:Arhgap42 UTSW 9 9009313 missense probably damaging 1.00
R0417:Arhgap42 UTSW 9 9180033 missense possibly damaging 0.55
R0513:Arhgap42 UTSW 9 9005765 missense probably benign 0.07
R1212:Arhgap42 UTSW 9 9015312 missense probably damaging 1.00
R1493:Arhgap42 UTSW 9 9030797 missense probably benign 0.01
R1499:Arhgap42 UTSW 9 9033586 splice site probably benign
R1674:Arhgap42 UTSW 9 9006584 missense probably damaging 0.99
R1687:Arhgap42 UTSW 9 9035537 missense probably benign 0.33
R1808:Arhgap42 UTSW 9 9180050 missense probably damaging 0.99
R1983:Arhgap42 UTSW 9 9017017 missense probably damaging 1.00
R2069:Arhgap42 UTSW 9 9035600 missense probably damaging 1.00
R2276:Arhgap42 UTSW 9 9035511 missense probably benign
R2279:Arhgap42 UTSW 9 9035511 missense probably benign
R2295:Arhgap42 UTSW 9 9115744 missense probably damaging 0.99
R3807:Arhgap42 UTSW 9 9008033 missense probably damaging 0.98
R4133:Arhgap42 UTSW 9 9011299 intron probably benign
R4530:Arhgap42 UTSW 9 9011432 missense probably damaging 1.00
R4532:Arhgap42 UTSW 9 9011432 missense probably damaging 1.00
R4786:Arhgap42 UTSW 9 9238698 nonsense probably null
R4807:Arhgap42 UTSW 9 9046628 missense possibly damaging 0.70
R4809:Arhgap42 UTSW 9 9180117 missense probably damaging 0.99
R4999:Arhgap42 UTSW 9 9009434 missense probably damaging 1.00
R5160:Arhgap42 UTSW 9 8997655 missense probably damaging 0.97
R5737:Arhgap42 UTSW 9 9059068 missense probably damaging 0.98
R5840:Arhgap42 UTSW 9 9046517 missense possibly damaging 0.94
R6172:Arhgap42 UTSW 9 9148245 missense possibly damaging 0.71
R6456:Arhgap42 UTSW 9 9005822 missense probably benign
R6782:Arhgap42 UTSW 9 9115720 missense probably damaging 0.99
R6846:Arhgap42 UTSW 9 9006445 missense probably damaging 1.00
R7489:Arhgap42 UTSW 9 9006358 missense probably benign
R7560:Arhgap42 UTSW 9 9035531 missense probably benign 0.00
X0066:Arhgap42 UTSW 9 9115700 missense probably damaging 1.00
X0066:Arhgap42 UTSW 9 9115704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGCTGCAGAGATGGATC -3'
(R):5'- TACCAGCACTGTTGTCTGTC -3'

Sequencing Primer
(F):5'- GAAGCAGAGGATCTTTTCAGTCC -3'
(R):5'- CTCCTCCTCAGGTGACTCCTACAG -3'
Posted On2015-06-20