Mutagenetix > Incidental Mutations

Incidental Mutation 'R4304:Arhgap42'

322542

Institutional Source

Beutler Lab

Gene Symbol

Arhgap42

Ensembl Gene

ENSMUSG00000050730

Gene Name

Rho GTPase activating protein 42

Synonyms

9030420J04Rik

MMRRC Submission

040865-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.891) question?

Stock #

R4304 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8994329-9239101 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9006488 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 636 (S636P)

Ref Sequence

ENSEMBL: ENSMUSP00000091419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093893]

Predicted Effect

probably benign
Transcript: ENSMUST00000093893
AA Change: S636P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000091419
Gene: ENSMUSG00000050730
AA Change: S636P

Domain	Start	End	E-Value	Type
Pfam:BAR_3	6	132	4.4e-36	PFAM
Pfam:BAR_3	125	215	8.9e-29	PFAM
PH	232	342	5.5e-8	SMART
RhoGAP	358	535	1.4e-55	SMART
low complexity region	583	596	N/A	INTRINSIC
low complexity region	599	616	N/A	INTRINSIC
Blast:RhoGAP	617	691	2e-37	BLAST
low complexity region	692	711	N/A	INTRINSIC
SH3	786	840	7.4e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182617

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit hypertension and increased vascular smooth muscle contractility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	C	T	6: 149,326,238	Q261*	probably null	Het
Adam32	A	T	8: 24,901,529	M323K	probably damaging	Het
Arhgef5	C	T	6: 43,279,498	A1180V	probably damaging	Het
Cep152	G	A	2: 125,563,723	Q1630*	probably null	Het
Cfap157	G	A	2: 32,779,042	R350W	probably damaging	Het
Csgalnact1	A	T	8: 68,372,642	V400D	possibly damaging	Het
Fig4	T	A	10: 41,256,427	D461V	probably benign	Het
Frmd4a	C	T	2: 4,333,078	R32C	probably benign	Het
Gcfc2	G	A	6: 81,943,007	R397Q	probably damaging	Het
Gm20939	A	C	17: 94,877,281	Q452H	probably benign	Het
Gm5592	A	T	7: 41,286,262	M63L	probably benign	Het
Gm7173	C	G	X: 79,498,029	K469N	probably damaging	Het
H2-M3	T	C	17: 37,272,404	M252T	probably benign	Het
Lsm14a	C	A	7: 34,357,433		probably null	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Npc1	C	T	18: 12,210,527	A470T	possibly damaging	Het
Oit1	G	A	14: 8,349,324	P209S	probably damaging	Het
Olfr1240	A	T	2: 89,440,198	V27D	probably damaging	Het
Prr27	A	G	5: 87,842,907	H126R	probably benign	Het
Rptn	C	A	3: 93,396,931	H524N	probably benign	Het
Slc4a11	A	T	2: 130,688,138	M240K	probably benign	Het
Smg1	T	C	7: 118,139,518	I3503V	probably benign	Het
Snx13	A	G	12: 35,122,942	K625E	probably benign	Het
Stk10	T	C	11: 32,610,634	V663A	probably damaging	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Tpp1	T	A	7: 105,750,309	D84V	possibly damaging	Het
Vmn1r238	T	A	18: 3,123,040	R125*	probably null	Het
Vmn2r12	A	G	5: 109,086,006	L780P	probably damaging	Het
Wfdc15b	A	C	2: 164,215,468	M1R	probably null	Het
Wnk2	C	T	13: 49,090,837	D508N	probably damaging	Het

Other mutations in Arhgap42

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Arhgap42	APN	9	9006343	missense	probably damaging	1.00
IGL00576:Arhgap42	APN	9	8997620	nonsense	probably null
IGL01693:Arhgap42	APN	9	9006506	missense	probably damaging	1.00
IGL01724:Arhgap42	APN	9	8998253	splice site	probably benign
IGL02142:Arhgap42	APN	9	9155359	missense	probably damaging	1.00
IGL02378:Arhgap42	APN	9	9035583	missense	possibly damaging	0.94
IGL02932:Arhgap42	APN	9	9115708	missense	probably damaging	0.98
IGL02992:Arhgap42	APN	9	8998248	splice site	probably benign
IGL03149:Arhgap42	APN	9	9008084	missense	possibly damaging	0.71
R0096:Arhgap42	UTSW	9	9009313	missense	probably damaging	1.00
R0096:Arhgap42	UTSW	9	9009313	missense	probably damaging	1.00
R0417:Arhgap42	UTSW	9	9180033	missense	possibly damaging	0.55
R0513:Arhgap42	UTSW	9	9005765	missense	probably benign	0.07
R1212:Arhgap42	UTSW	9	9015312	missense	probably damaging	1.00
R1493:Arhgap42	UTSW	9	9030797	missense	probably benign	0.01
R1499:Arhgap42	UTSW	9	9033586	splice site	probably benign
R1674:Arhgap42	UTSW	9	9006584	missense	probably damaging	0.99
R1687:Arhgap42	UTSW	9	9035537	missense	probably benign	0.33
R1808:Arhgap42	UTSW	9	9180050	missense	probably damaging	0.99
R1983:Arhgap42	UTSW	9	9017017	missense	probably damaging	1.00
R2069:Arhgap42	UTSW	9	9035600	missense	probably damaging	1.00
R2276:Arhgap42	UTSW	9	9035511	missense	probably benign
R2279:Arhgap42	UTSW	9	9035511	missense	probably benign
R2295:Arhgap42	UTSW	9	9115744	missense	probably damaging	0.99
R3807:Arhgap42	UTSW	9	9008033	missense	probably damaging	0.98
R4133:Arhgap42	UTSW	9	9011299	intron	probably benign
R4530:Arhgap42	UTSW	9	9011432	missense	probably damaging	1.00
R4532:Arhgap42	UTSW	9	9011432	missense	probably damaging	1.00
R4786:Arhgap42	UTSW	9	9238698	nonsense	probably null
R4807:Arhgap42	UTSW	9	9046628	missense	possibly damaging	0.70
R4809:Arhgap42	UTSW	9	9180117	missense	probably damaging	0.99
R4999:Arhgap42	UTSW	9	9009434	missense	probably damaging	1.00
R5160:Arhgap42	UTSW	9	8997655	missense	probably damaging	0.97
R5737:Arhgap42	UTSW	9	9059068	missense	probably damaging	0.98
R5840:Arhgap42	UTSW	9	9046517	missense	possibly damaging	0.94
R6172:Arhgap42	UTSW	9	9148245	missense	possibly damaging	0.71
R6456:Arhgap42	UTSW	9	9005822	missense	probably benign
R6782:Arhgap42	UTSW	9	9115720	missense	probably damaging	0.99
R6846:Arhgap42	UTSW	9	9006445	missense	probably damaging	1.00
R7489:Arhgap42	UTSW	9	9006358	missense	probably benign
R7560:Arhgap42	UTSW	9	9035531	missense	probably benign	0.00
R8025:Arhgap42	UTSW	9	9005822	missense	probably benign
R8113:Arhgap42	UTSW	9	9011433	missense	probably damaging	1.00
R8303:Arhgap42	UTSW	9	9009326	missense	probably damaging	1.00
R8357:Arhgap42	UTSW	9	9016220	missense	probably benign	0.40
R8457:Arhgap42	UTSW	9	9016220	missense	probably benign	0.40
X0066:Arhgap42	UTSW	9	9115700	missense	probably damaging	1.00
X0066:Arhgap42	UTSW	9	9115704	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAGCTGCAGAGATGGATC -3'
(R):5'- TACCAGCACTGTTGTCTGTC -3'

Sequencing Primer
(F):5'- GAAGCAGAGGATCTTTTCAGTCC -3'
(R):5'- CTCCTCCTCAGGTGACTCCTACAG -3'

Posted On

2015-06-20