Incidental Mutation 'R4304:Oit1'
ID322547
Institutional Source Beutler Lab
Gene Symbol Oit1
Ensembl Gene ENSMUSG00000021749
Gene Nameoncoprotein induced transcript 1
SynonymsEF-7, Fam3d, 2310076N21Rik
MMRRC Submission 040865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4304 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location8348937-8378754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8349324 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 209 (P209S)
Ref Sequence ENSEMBL: ENSMUSP00000022269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022269]
Predicted Effect probably damaging
Transcript: ENSMUST00000022269
AA Change: P209S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022269
Gene: ENSMUSG00000021749
AA Change: P209S

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Pfam:ILEI 98 190 3.1e-31 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a targeted mutation exhibit emotion/affect abnormalities including decreased anxiety and depression responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,238 Q261* probably null Het
Adam32 A T 8: 24,901,529 M323K probably damaging Het
Arhgap42 A G 9: 9,006,488 S636P probably benign Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Cep152 G A 2: 125,563,723 Q1630* probably null Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Csgalnact1 A T 8: 68,372,642 V400D possibly damaging Het
Fig4 T A 10: 41,256,427 D461V probably benign Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gcfc2 G A 6: 81,943,007 R397Q probably damaging Het
Gm20939 A C 17: 94,877,281 Q452H probably benign Het
Gm5592 A T 7: 41,286,262 M63L probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
H2-M3 T C 17: 37,272,404 M252T probably benign Het
Lsm14a C A 7: 34,357,433 probably null Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Olfr1240 A T 2: 89,440,198 V27D probably damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rptn C A 3: 93,396,931 H524N probably benign Het
Slc4a11 A T 2: 130,688,138 M240K probably benign Het
Smg1 T C 7: 118,139,518 I3503V probably benign Het
Snx13 A G 12: 35,122,942 K625E probably benign Het
Stk10 T C 11: 32,610,634 V663A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpp1 T A 7: 105,750,309 D84V possibly damaging Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wfdc15b A C 2: 164,215,468 M1R probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Oit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02795:Oit1 APN 14 8355497 missense probably benign
IGL02850:Oit1 APN 14 8361475 critical splice donor site probably null
R0899:Oit1 UTSW 14 8364863 missense probably damaging 0.99
R2098:Oit1 UTSW 14 8361479 missense probably benign 0.14
R4356:Oit1 UTSW 14 8349314 missense probably damaging 1.00
R4603:Oit1 UTSW 14 8358429 missense probably damaging 0.99
R4705:Oit1 UTSW 14 8349347 missense probably benign 0.01
R5650:Oit1 UTSW 14 8357142 missense probably damaging 0.99
R5679:Oit1 UTSW 14 8349305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCAGAGCGTACCATATGGC -3'
(R):5'- AGTAGGCTCTGACCCCATTG -3'

Sequencing Primer
(F):5'- AGAGCGTACCATATGGCTTCTTTC -3'
(R):5'- AGCAAGTTGTGGTCCTGCC -3'
Posted On2015-06-20