Mutagenetix > Incidental Mutations

Incidental Mutation 'R4304:H2-M3'

322548

Institutional Source

Beutler Lab

Gene Symbol

H2-M3

Ensembl Gene

ENSMUSG00000016206

Gene Name

histocompatibility 2, M region locus 3

Synonyms

H-2M3, Hmt, R4B2

MMRRC Submission

040865-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4304 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37270220-37274484 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37272404 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 252 (M252T)

Ref Sequence

ENSEMBL: ENSMUSP00000035687 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038580]

PDB Structure

MODEL OF MHC CLASS I H2-M3 WITH NONAPEPTIDE FROM RAT ND1 REFINED AT 2.3 ANGSTROMS RESOLUTION [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000038580
AA Change: M252T

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000035687
Gene: ENSMUSG00000016206
AA Change: M252T

Domain	Start	End	E-Value	Type
Pfam:MHC_I	25	203	6.6e-76	PFAM
IGc1	222	293	4.91e-21	SMART
transmembrane domain	306	328	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173568

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-G belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-G is expressed on fetal derived placental cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exon 6 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
PHENOTYPE: At least three alleles are known for this locus: allele a, found in C57BL/6, C3H-Pgk1a, NZO and NMRI, and allele c, found in M. spretus determine distinct antigen specificities. Allele b, found in M.m. castaneus results in absence of antigen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	C	T	6: 149,326,238	Q261*	probably null	Het
Adam32	A	T	8: 24,901,529	M323K	probably damaging	Het
Arhgap42	A	G	9: 9,006,488	S636P	probably benign	Het
Arhgef5	C	T	6: 43,279,498	A1180V	probably damaging	Het
Cep152	G	A	2: 125,563,723	Q1630*	probably null	Het
Cfap157	G	A	2: 32,779,042	R350W	probably damaging	Het
Csgalnact1	A	T	8: 68,372,642	V400D	possibly damaging	Het
Fig4	T	A	10: 41,256,427	D461V	probably benign	Het
Frmd4a	C	T	2: 4,333,078	R32C	probably benign	Het
Gcfc2	G	A	6: 81,943,007	R397Q	probably damaging	Het
Gm20939	A	C	17: 94,877,281	Q452H	probably benign	Het
Gm5592	A	T	7: 41,286,262	M63L	probably benign	Het
Gm7173	C	G	X: 79,498,029	K469N	probably damaging	Het
Lsm14a	C	A	7: 34,357,433		probably null	Het
Map4k4	T	C	1: 39,973,972	Y76H	possibly damaging	Het
Npc1	C	T	18: 12,210,527	A470T	possibly damaging	Het
Oit1	G	A	14: 8,349,324	P209S	probably damaging	Het
Olfr1240	A	T	2: 89,440,198	V27D	probably damaging	Het
Prr27	A	G	5: 87,842,907	H126R	probably benign	Het
Rptn	C	A	3: 93,396,931	H524N	probably benign	Het
Slc4a11	A	T	2: 130,688,138	M240K	probably benign	Het
Smg1	T	C	7: 118,139,518	I3503V	probably benign	Het
Snx13	A	G	12: 35,122,942	K625E	probably benign	Het
Stk10	T	C	11: 32,610,634	V663A	probably damaging	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Tpp1	T	A	7: 105,750,309	D84V	possibly damaging	Het
Vmn1r238	T	A	18: 3,123,040	R125*	probably null	Het
Vmn2r12	A	G	5: 109,086,006	L780P	probably damaging	Het
Wfdc15b	A	C	2: 164,215,468	M1R	probably null	Het
Wnk2	C	T	13: 49,090,837	D508N	probably damaging	Het

Other mutations in H2-M3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01630:H2-M3	APN	17	37270657	missense	possibly damaging	0.89
IGL01891:H2-M3	APN	17	37272717	missense	probably benign	0.23
IGL02689:H2-M3	APN	17	37270541	nonsense	probably null
IGL02755:H2-M3	APN	17	37271022	missense	possibly damaging	0.81
IGL02994:H2-M3	APN	17	37270738	missense	probably benign
IGL03135:H2-M3	APN	17	37272433	missense	possibly damaging	0.90
IGL03177:H2-M3	APN	17	37270316	missense	possibly damaging	0.86
R1328:H2-M3	UTSW	17	37271034	missense	possibly damaging	0.71
R1632:H2-M3	UTSW	17	37271163	missense	probably benign	0.01
R1919:H2-M3	UTSW	17	37271189	missense	possibly damaging	0.67
R3981:H2-M3	UTSW	17	37271130	missense	probably damaging	0.97
R4620:H2-M3	UTSW	17	37272419	missense	probably damaging	0.97
R5765:H2-M3	UTSW	17	37272443	missense	probably damaging	0.97
R7262:H2-M3	UTSW	17	37271193	missense	probably damaging	1.00
R7437:H2-M3	UTSW	17	37272678	missense	probably benign	0.23
R7585:H2-M3	UTSW	17	37270708	missense	probably damaging	1.00
R7645:H2-M3	UTSW	17	37270729	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGATGCTCCTATGATCTCCAATG -3'
(R):5'- AGGGTGAGAGTCATGATGCC -3'

Sequencing Primer
(F):5'- TCTCCAATGACTCTCCAAAAATAATG -3'
(R):5'- AGAGTCATGATGCCCAGTTC -3'

Posted On

2015-06-20