Incidental Mutation 'R4304:H2-M3'
ID 322548
Institutional Source Beutler Lab
Gene Symbol H2-M3
Ensembl Gene ENSMUSG00000016206
Gene Name histocompatibility 2, M region locus 3
Synonyms H-2M3, Hmt, R4B2
MMRRC Submission 040865-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4304 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 37270220-37274484 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37272404 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 252 (M252T)
Ref Sequence ENSEMBL: ENSMUSP00000035687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038580]
AlphaFold Q31093
PDB Structure MODEL OF MHC CLASS I H2-M3 WITH NONAPEPTIDE FROM RAT ND1 REFINED AT 2.3 ANGSTROMS RESOLUTION [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000038580
AA Change: M252T

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035687
Gene: ENSMUSG00000016206
AA Change: M252T

DomainStartEndE-ValueType
Pfam:MHC_I 25 203 6.6e-76 PFAM
IGc1 222 293 4.91e-21 SMART
transmembrane domain 306 328 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173568
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-G belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-G is expressed on fetal derived placental cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exon 6 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
PHENOTYPE: At least three alleles are known for this locus: allele a, found in C57BL/6, C3H-Pgk1a, NZO and NMRI, and allele c, found in M. spretus determine distinct antigen specificities. Allele b, found in M.m. castaneus results in absence of antigen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,238 Q261* probably null Het
Adam32 A T 8: 24,901,529 M323K probably damaging Het
Arhgap42 A G 9: 9,006,488 S636P probably benign Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Cep152 G A 2: 125,563,723 Q1630* probably null Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Csgalnact1 A T 8: 68,372,642 V400D possibly damaging Het
Fig4 T A 10: 41,256,427 D461V probably benign Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gcfc2 G A 6: 81,943,007 R397Q probably damaging Het
Gm20939 A C 17: 94,877,281 Q452H probably benign Het
Gm5592 A T 7: 41,286,262 M63L probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
Lsm14a C A 7: 34,357,433 probably null Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Oit1 G A 14: 8,349,324 P209S probably damaging Het
Olfr1240 A T 2: 89,440,198 V27D probably damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rptn C A 3: 93,396,931 H524N probably benign Het
Slc4a11 A T 2: 130,688,138 M240K probably benign Het
Smg1 T C 7: 118,139,518 I3503V probably benign Het
Snx13 A G 12: 35,122,942 K625E probably benign Het
Stk10 T C 11: 32,610,634 V663A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpp1 T A 7: 105,750,309 D84V possibly damaging Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wfdc15b A C 2: 164,215,468 M1R probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in H2-M3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:H2-M3 APN 17 37270657 missense possibly damaging 0.89
IGL01891:H2-M3 APN 17 37272717 missense probably benign 0.23
IGL02689:H2-M3 APN 17 37270541 nonsense probably null
IGL02755:H2-M3 APN 17 37271022 missense possibly damaging 0.81
IGL02994:H2-M3 APN 17 37270738 missense probably benign
IGL03135:H2-M3 APN 17 37272433 missense possibly damaging 0.90
IGL03177:H2-M3 APN 17 37270316 missense possibly damaging 0.86
R1328:H2-M3 UTSW 17 37271034 missense possibly damaging 0.71
R1632:H2-M3 UTSW 17 37271163 missense probably benign 0.01
R1919:H2-M3 UTSW 17 37271189 missense possibly damaging 0.67
R3981:H2-M3 UTSW 17 37271130 missense probably damaging 0.97
R4620:H2-M3 UTSW 17 37272419 missense probably damaging 0.97
R5765:H2-M3 UTSW 17 37272443 missense probably damaging 0.97
R7262:H2-M3 UTSW 17 37271193 missense probably damaging 1.00
R7437:H2-M3 UTSW 17 37272678 missense probably benign 0.23
R7585:H2-M3 UTSW 17 37270708 missense probably damaging 1.00
R7645:H2-M3 UTSW 17 37270729 missense probably damaging 0.99
R9181:H2-M3 UTSW 17 37272281 missense probably damaging 0.99
R9471:H2-M3 UTSW 17 37271097 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGATGCTCCTATGATCTCCAATG -3'
(R):5'- AGGGTGAGAGTCATGATGCC -3'

Sequencing Primer
(F):5'- TCTCCAATGACTCTCCAAAAATAATG -3'
(R):5'- AGAGTCATGATGCCCAGTTC -3'
Posted On 2015-06-20