Incidental Mutation 'R4304:Gm20939'
ID322549
Institutional Source Beutler Lab
Gene Symbol Gm20939
Ensembl Gene ENSMUSG00000095193
Gene Namepredicted gene, 20939
Synonyms
MMRRC Submission 040865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4304 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location94873986-94877497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 94877281 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 452 (Q452H)
Ref Sequence ENSEMBL: ENSMUSP00000103642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108007]
Predicted Effect probably benign
Transcript: ENSMUST00000108007
AA Change: Q452H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103642
Gene: ENSMUSG00000095193
AA Change: Q452H

DomainStartEndE-ValueType
KRAB 3 65 7.59e-15 SMART
ZnF_C2H2 130 152 5.21e-4 SMART
ZnF_C2H2 158 180 1.18e-2 SMART
ZnF_C2H2 186 208 2.12e-4 SMART
ZnF_C2H2 214 236 2.57e-3 SMART
ZnF_C2H2 242 264 1.3e-4 SMART
ZnF_C2H2 270 292 2.99e-4 SMART
ZnF_C2H2 298 320 7.9e-4 SMART
ZnF_C2H2 326 348 1.6e-4 SMART
ZnF_C2H2 354 376 4.24e-4 SMART
ZnF_C2H2 382 404 2.79e-4 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 1.22e-4 SMART
ZnF_C2H2 466 488 4.17e-3 SMART
ZnF_C2H2 494 516 1.6e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,238 Q261* probably null Het
Adam32 A T 8: 24,901,529 M323K probably damaging Het
Arhgap42 A G 9: 9,006,488 S636P probably benign Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Cep152 G A 2: 125,563,723 Q1630* probably null Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Csgalnact1 A T 8: 68,372,642 V400D possibly damaging Het
Fig4 T A 10: 41,256,427 D461V probably benign Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gcfc2 G A 6: 81,943,007 R397Q probably damaging Het
Gm5592 A T 7: 41,286,262 M63L probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
H2-M3 T C 17: 37,272,404 M252T probably benign Het
Lsm14a C A 7: 34,357,433 probably null Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Oit1 G A 14: 8,349,324 P209S probably damaging Het
Olfr1240 A T 2: 89,440,198 V27D probably damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rptn C A 3: 93,396,931 H524N probably benign Het
Slc4a11 A T 2: 130,688,138 M240K probably benign Het
Smg1 T C 7: 118,139,518 I3503V probably benign Het
Snx13 A G 12: 35,122,942 K625E probably benign Het
Stk10 T C 11: 32,610,634 V663A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpp1 T A 7: 105,750,309 D84V possibly damaging Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wfdc15b A C 2: 164,215,468 M1R probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Gm20939
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Gm20939 APN 17 94874293 splice site probably benign
R0015:Gm20939 UTSW 17 94876768 missense probably benign 0.00
R1563:Gm20939 UTSW 17 94877094 missense probably damaging 1.00
R1714:Gm20939 UTSW 17 94875806 missense probably damaging 1.00
R2029:Gm20939 UTSW 17 94875824 splice site probably benign
R2922:Gm20939 UTSW 17 94877293 missense probably damaging 1.00
R2923:Gm20939 UTSW 17 94877293 missense probably damaging 1.00
R3158:Gm20939 UTSW 17 94877293 missense probably damaging 1.00
R3810:Gm20939 UTSW 17 94876710 missense possibly damaging 0.46
R4158:Gm20939 UTSW 17 94876734 missense possibly damaging 0.72
R4307:Gm20939 UTSW 17 94876734 missense possibly damaging 0.72
R5080:Gm20939 UTSW 17 94876991 missense probably damaging 1.00
R5271:Gm20939 UTSW 17 94877155 nonsense probably null
R5661:Gm20939 UTSW 17 94875779 missense probably damaging 1.00
R5771:Gm20939 UTSW 17 94874339 missense possibly damaging 0.93
R6800:Gm20939 UTSW 17 94877229 missense possibly damaging 0.75
R8393:Gm20939 UTSW 17 94875779 missense probably damaging 1.00
R8791:Gm20939 UTSW 17 94877220 missense probably damaging 1.00
Z1088:Gm20939 UTSW 17 94877433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGGACGACACAGTCATCTCA -3'
(R):5'- TATGATATGCAATGGCTTTGTCAC -3'

Sequencing Primer
(F):5'- GTGATCAATGTGGTAAAGCCTTTCC -3'
(R):5'- ATATGCAATGGCTTTGTCACATTGG -3'
Posted On2015-06-20