Incidental Mutation 'R4304:Vmn1r238'
ID 322550
Institutional Source Beutler Lab
Gene Symbol Vmn1r238
Ensembl Gene ENSMUSG00000091539
Gene Name vomeronasal 1 receptor, 238
Synonyms
MMRRC Submission 040865-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R4304 (G1)
Quality Score 156
Status Not validated
Chromosome 18
Chromosomal Location 3122492-3123412 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 3123040 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 125 (R125*)
Ref Sequence ENSEMBL: ENSMUSP00000129804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165255]
AlphaFold E9Q373
Predicted Effect probably null
Transcript: ENSMUST00000165255
AA Change: R125*
SMART Domains Protein: ENSMUSP00000129804
Gene: ENSMUSG00000091539
AA Change: R125*

DomainStartEndE-ValueType
Pfam:TAS2R 7 302 5.3e-8 PFAM
Pfam:7tm_1 27 292 8.8e-7 PFAM
Pfam:V1R 34 298 1.9e-33 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 25,391,545 (GRCm39) M323K probably damaging Het
Arhgap42 A G 9: 9,006,489 (GRCm39) S636P probably benign Het
Arhgef5 C T 6: 43,256,432 (GRCm39) A1180V probably damaging Het
Cep152 G A 2: 125,405,643 (GRCm39) Q1630* probably null Het
Cfap157 G A 2: 32,669,054 (GRCm39) R350W probably damaging Het
Cfap47 C G X: 78,541,635 (GRCm39) K469N probably damaging Het
Csgalnact1 A T 8: 68,825,294 (GRCm39) V400D possibly damaging Het
Fam3d G A 14: 8,349,324 (GRCm38) P209S probably damaging Het
Fig4 T A 10: 41,132,423 (GRCm39) D461V probably benign Het
Frmd4a C T 2: 4,337,889 (GRCm39) R32C probably benign Het
Gcfc2 G A 6: 81,919,988 (GRCm39) R397Q probably damaging Het
Gm20939 A C 17: 95,184,709 (GRCm39) Q452H probably benign Het
Gm5592 A T 7: 40,935,686 (GRCm39) M63L probably benign Het
H2-M3 T C 17: 37,583,295 (GRCm39) M252T probably benign Het
Lsm14a C A 7: 34,056,858 (GRCm39) probably null Het
Map4k4 T C 1: 40,013,132 (GRCm39) Y76H possibly damaging Het
Npc1 C T 18: 12,343,584 (GRCm39) A470T possibly damaging Het
Or4a68 A T 2: 89,270,542 (GRCm39) V27D probably damaging Het
Prr27 A G 5: 87,990,766 (GRCm39) H126R probably benign Het
Resf1 C T 6: 149,227,736 (GRCm39) Q261* probably null Het
Rptn C A 3: 93,304,238 (GRCm39) H524N probably benign Het
Slc4a11 A T 2: 130,530,058 (GRCm39) M240K probably benign Het
Smg1 T C 7: 117,738,741 (GRCm39) I3503V probably benign Het
Snx13 A G 12: 35,172,941 (GRCm39) K625E probably benign Het
Stk10 T C 11: 32,560,634 (GRCm39) V663A probably damaging Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tpp1 T A 7: 105,399,516 (GRCm39) D84V possibly damaging Het
Vmn2r12 A G 5: 109,233,872 (GRCm39) L780P probably damaging Het
Wfdc15b A C 2: 164,057,388 (GRCm39) M1R probably null Het
Wnk2 C T 13: 49,244,313 (GRCm39) D508N probably damaging Het
Other mutations in Vmn1r238
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn1r238 APN 18 3,123,243 (GRCm39) missense probably benign 0.01
IGL01385:Vmn1r238 APN 18 3,122,770 (GRCm39) missense possibly damaging 0.83
IGL02716:Vmn1r238 APN 18 3,123,124 (GRCm39) missense probably damaging 1.00
R1219:Vmn1r238 UTSW 18 3,123,135 (GRCm39) missense possibly damaging 0.81
R1568:Vmn1r238 UTSW 18 3,123,358 (GRCm39) missense probably benign 0.00
R1864:Vmn1r238 UTSW 18 3,123,040 (GRCm39) nonsense probably null
R3024:Vmn1r238 UTSW 18 3,123,305 (GRCm39) missense probably benign 0.13
R4291:Vmn1r238 UTSW 18 3,123,214 (GRCm39) nonsense probably null
R4586:Vmn1r238 UTSW 18 3,123,294 (GRCm39) missense probably damaging 1.00
R4664:Vmn1r238 UTSW 18 3,123,300 (GRCm39) missense probably damaging 0.99
R5123:Vmn1r238 UTSW 18 3,123,243 (GRCm39) missense probably benign
R5430:Vmn1r238 UTSW 18 3,122,521 (GRCm39) missense possibly damaging 0.63
R5834:Vmn1r238 UTSW 18 3,123,168 (GRCm39) missense probably benign
R7186:Vmn1r238 UTSW 18 3,122,661 (GRCm39) missense probably damaging 0.99
R7206:Vmn1r238 UTSW 18 3,122,623 (GRCm39) missense possibly damaging 0.94
R7308:Vmn1r238 UTSW 18 3,122,875 (GRCm39) missense probably benign 0.09
R7346:Vmn1r238 UTSW 18 3,123,151 (GRCm39) missense probably damaging 1.00
R7467:Vmn1r238 UTSW 18 3,123,393 (GRCm39) missense probably benign 0.10
R7571:Vmn1r238 UTSW 18 3,122,721 (GRCm39) missense probably damaging 1.00
R7808:Vmn1r238 UTSW 18 3,123,033 (GRCm39) missense probably benign 0.03
R8085:Vmn1r238 UTSW 18 3,123,151 (GRCm39) missense probably damaging 1.00
R8086:Vmn1r238 UTSW 18 3,123,250 (GRCm39) missense probably damaging 1.00
R8325:Vmn1r238 UTSW 18 3,122,529 (GRCm39) missense probably benign 0.00
R8423:Vmn1r238 UTSW 18 3,123,365 (GRCm39) nonsense probably null
R8747:Vmn1r238 UTSW 18 3,123,232 (GRCm39) missense possibly damaging 0.87
R8930:Vmn1r238 UTSW 18 3,123,127 (GRCm39) missense probably benign 0.03
R8932:Vmn1r238 UTSW 18 3,123,127 (GRCm39) missense probably benign 0.03
R9279:Vmn1r238 UTSW 18 3,122,994 (GRCm39) missense probably damaging 0.99
R9382:Vmn1r238 UTSW 18 3,122,676 (GRCm39) missense probably damaging 0.99
R9644:Vmn1r238 UTSW 18 3,122,635 (GRCm39) missense probably benign 0.10
R9725:Vmn1r238 UTSW 18 3,122,577 (GRCm39) missense probably benign 0.00
Z1177:Vmn1r238 UTSW 18 3,122,505 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTGCTACACTGTCAGAAGC -3'
(R):5'- GCATTTAACGCCCAAAGTCC -3'

Sequencing Primer
(F):5'- TGCTACACTGTCAGAAGCAAACAATG -3'
(R):5'- AGGGTTTCCACAGACAATGTC -3'
Posted On 2015-06-20