Incidental Mutation 'R4304:Gm7173'
ID322552
Institutional Source Beutler Lab
Gene Symbol Gm7173
Ensembl Gene ENSMUSG00000073077
Gene Namepredicted gene 7173
Synonyms
MMRRC Submission 040865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4304 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location79266559-79517285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 79498029 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 469 (K469N)
Ref Sequence ENSEMBL: ENSMUSP00000098956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101410] [ENSMUST00000197180]
Predicted Effect probably damaging
Transcript: ENSMUST00000101410
AA Change: K469N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098956
Gene: ENSMUSG00000073077
AA Change: K469N

DomainStartEndE-ValueType
SCOP:d1grwa_ 390 460 1e-2 SMART
low complexity region 597 608 N/A INTRINSIC
low complexity region 653 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197180
AA Change: K469N

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142707
Gene: ENSMUSG00000073077
AA Change: K469N

DomainStartEndE-ValueType
low complexity region 597 608 N/A INTRINSIC
low complexity region 653 676 N/A INTRINSIC
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1599 1611 N/A INTRINSIC
CH 1679 1797 9e-6 SMART
low complexity region 2440 2451 N/A INTRINSIC
low complexity region 2578 2590 N/A INTRINSIC
low complexity region 2901 2911 N/A INTRINSIC
Meta Mutation Damage Score 0.1961 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,238 Q261* probably null Het
Adam32 A T 8: 24,901,529 M323K probably damaging Het
Arhgap42 A G 9: 9,006,488 S636P probably benign Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Cep152 G A 2: 125,563,723 Q1630* probably null Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Csgalnact1 A T 8: 68,372,642 V400D possibly damaging Het
Fig4 T A 10: 41,256,427 D461V probably benign Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gcfc2 G A 6: 81,943,007 R397Q probably damaging Het
Gm20939 A C 17: 94,877,281 Q452H probably benign Het
Gm5592 A T 7: 41,286,262 M63L probably benign Het
H2-M3 T C 17: 37,272,404 M252T probably benign Het
Lsm14a C A 7: 34,357,433 probably null Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Oit1 G A 14: 8,349,324 P209S probably damaging Het
Olfr1240 A T 2: 89,440,198 V27D probably damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rptn C A 3: 93,396,931 H524N probably benign Het
Slc4a11 A T 2: 130,688,138 M240K probably benign Het
Smg1 T C 7: 118,139,518 I3503V probably benign Het
Snx13 A G 12: 35,122,942 K625E probably benign Het
Stk10 T C 11: 32,610,634 V663A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpp1 T A 7: 105,750,309 D84V possibly damaging Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wfdc15b A C 2: 164,215,468 M1R probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Gm7173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Gm7173 APN X 79489158 missense possibly damaging 0.87
IGL02025:Gm7173 APN X 79510430 missense probably benign 0.16
IGL02632:Gm7173 APN X 79496673 missense probably damaging 1.00
R1386:Gm7173 UTSW X 79509901 missense possibly damaging 0.54
R1551:Gm7173 UTSW X 79488645 missense probably damaging 1.00
R2121:Gm7173 UTSW X 79510321 missense probably benign 0.04
R2124:Gm7173 UTSW X 79510321 missense probably benign 0.04
R2192:Gm7173 UTSW X 79410612 missense probably damaging 1.00
R3725:Gm7173 UTSW X 79510015 missense probably damaging 0.97
R4305:Gm7173 UTSW X 79498029 missense probably damaging 1.00
R4522:Gm7173 UTSW X 79509995 missense possibly damaging 0.63
R4523:Gm7173 UTSW X 79509995 missense possibly damaging 0.63
Z1088:Gm7173 UTSW X 79330813 missense probably damaging 1.00
Z1088:Gm7173 UTSW X 79330814 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGGAAAAGCACTGTTTTGAAC -3'
(R):5'- AATTGCTTATAAATCCCCGTGGTG -3'

Sequencing Primer
(F):5'- GAAAATCACATCACAGCTATGTAGG -3'
(R):5'- ATCCCCGTGGTGAAAATATGTTGC -3'
Posted On2015-06-20