Incidental Mutation 'R4304:Tex11'
ID 322553
Institutional Source Beutler Lab
Gene Symbol Tex11
Ensembl Gene ENSMUSG00000009670
Gene Name testis expressed gene 11
Synonyms 4930565P14Rik
MMRRC Submission 040865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock # R4304 (G1)
Quality Score 222
Status Not validated
Chromosome X
Chromosomal Location 100838648-101059667 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 100933415 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 487 (A487S)
Ref Sequence ENSEMBL: ENSMUSP00000109347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009814] [ENSMUST00000113716] [ENSMUST00000113718]
AlphaFold Q14AT2
Predicted Effect possibly damaging
Transcript: ENSMUST00000009814
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000009814
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 176 431 1.1e-62 PFAM
low complexity region 702 713 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113716
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109345
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 175 433 2.1e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113718
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109347
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 175 433 3.8e-70 PFAM
low complexity region 702 713 N/A INTRINSIC
Meta Mutation Damage Score 0.3188 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is X-linked and is expressed in only male germ cells. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Miche homozygous for a knockout allele exhibit abnormal male meiosis. Mice homozygous for a conditional knockout exhibit male infertility and reduced female fecundity due to abnormal meiosis following cre recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,238 Q261* probably null Het
Adam32 A T 8: 24,901,529 M323K probably damaging Het
Arhgap42 A G 9: 9,006,488 S636P probably benign Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Cep152 G A 2: 125,563,723 Q1630* probably null Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Csgalnact1 A T 8: 68,372,642 V400D possibly damaging Het
Fig4 T A 10: 41,256,427 D461V probably benign Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gcfc2 G A 6: 81,943,007 R397Q probably damaging Het
Gm20939 A C 17: 94,877,281 Q452H probably benign Het
Gm5592 A T 7: 41,286,262 M63L probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
H2-M3 T C 17: 37,272,404 M252T probably benign Het
Lsm14a C A 7: 34,357,433 probably null Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Oit1 G A 14: 8,349,324 P209S probably damaging Het
Olfr1240 A T 2: 89,440,198 V27D probably damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rptn C A 3: 93,396,931 H524N probably benign Het
Slc4a11 A T 2: 130,688,138 M240K probably benign Het
Smg1 T C 7: 118,139,518 I3503V probably benign Het
Snx13 A G 12: 35,122,942 K625E probably benign Het
Stk10 T C 11: 32,610,634 V663A probably damaging Het
Tpp1 T A 7: 105,750,309 D84V possibly damaging Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wfdc15b A C 2: 164,215,468 M1R probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Tex11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Tex11 APN X 101032559 missense probably null 0.00
IGL00838:Tex11 APN X 100972118 missense possibly damaging 0.92
IGL02385:Tex11 APN X 100876529 splice site probably benign
R2958:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R2960:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R2963:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3008:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3009:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3010:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3011:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3745:Tex11 UTSW X 100916572 missense probably benign 0.33
R3881:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3882:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4081:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4082:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4159:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4172:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4197:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4201:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4204:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4206:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4305:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R8726:Tex11 UTSW X 101015585 missense possibly damaging 0.82
R8727:Tex11 UTSW X 101015585 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATGATGGTTTCCCGAATTCTTG -3'
(R):5'- GAGTACTCCTCAACAATTGTGTC -3'

Sequencing Primer
(F):5'- CTTGTCCAATATTTGCCCATTTAAG -3'
(R):5'- GCCATAGCAGAAGTTGAG -3'
Posted On 2015-06-20