Incidental Mutation 'R4259:Olfr1076'
ID322554
Institutional Source Beutler Lab
Gene Symbol Olfr1076
Ensembl Gene ENSMUSG00000060742
Gene Nameolfactory receptor 1076
SynonymsGA_x6K02T2Q125-47993761-47994702, MOR189-2
MMRRC Submission 041072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4259 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86508461-86509402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86508999 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 180 (D180G)
Ref Sequence ENSEMBL: ENSMUSP00000075612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076263]
Predicted Effect probably damaging
Transcript: ENSMUST00000076263
AA Change: D180G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075612
Gene: ENSMUSG00000060742
AA Change: D180G

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.6e-52 PFAM
Pfam:7tm_1 41 290 5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217442
Meta Mutation Damage Score 0.1898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Cd248 A G 19: 5,068,838 D238G probably damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cyp2b19 G A 7: 26,763,382 G230S probably damaging Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gpr171 A G 3: 59,097,527 S276P probably damaging Het
Hap1 C A 11: 100,351,842 probably null Het
Hcn1 A T 13: 117,975,348 K616M unknown Het
Igkv4-90 T C 6: 68,807,477 I18M possibly damaging Het
Itpr3 T A 17: 27,106,324 V1297E probably damaging Het
Kmt2b T C 7: 30,581,081 N1319D probably damaging Het
Krt72 T C 15: 101,778,257 E418G probably damaging Het
Lama1 T C 17: 67,752,418 S599P possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrk1 A T 7: 66,330,764 Y223N probably damaging Het
Olfr150 A T 9: 39,737,703 D296V probably damaging Het
Olfr480 T A 7: 108,065,893 K272* probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pdk2 T C 11: 95,041,144 D38G probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Prl3b1 T C 13: 27,243,906 probably null Het
Sat1 T C X: 155,215,186 probably benign Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc26a1 T A 5: 108,672,630 K250N probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Tbc1d32 A G 10: 56,049,771 S1093P probably damaging Het
Other mutations in Olfr1076
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Olfr1076 APN 2 86509169 missense possibly damaging 0.91
IGL03157:Olfr1076 APN 2 86509023 missense possibly damaging 0.95
ANU05:Olfr1076 UTSW 2 86509169 missense possibly damaging 0.91
IGL02802:Olfr1076 UTSW 2 86508946 missense probably benign
R0325:Olfr1076 UTSW 2 86509205 missense probably benign 0.14
R0384:Olfr1076 UTSW 2 86509383 missense possibly damaging 0.80
R1164:Olfr1076 UTSW 2 86508684 missense probably damaging 1.00
R1618:Olfr1076 UTSW 2 86508849 missense probably damaging 1.00
R1915:Olfr1076 UTSW 2 86508999 missense probably damaging 1.00
R1999:Olfr1076 UTSW 2 86508745 nonsense probably null
R2093:Olfr1076 UTSW 2 86509243 missense probably damaging 0.99
R3824:Olfr1076 UTSW 2 86509023 missense possibly damaging 0.95
R4928:Olfr1076 UTSW 2 86509125 missense probably damaging 1.00
R4981:Olfr1076 UTSW 2 86508827 missense probably damaging 1.00
R4998:Olfr1076 UTSW 2 86509355 missense probably benign 0.00
R5783:Olfr1076 UTSW 2 86508638 missense probably damaging 1.00
R6384:Olfr1076 UTSW 2 86509037 missense probably benign
R6549:Olfr1076 UTSW 2 86509382 missense probably benign 0.00
R6893:Olfr1076 UTSW 2 86508792 missense probably damaging 1.00
R7145:Olfr1076 UTSW 2 86508528 missense probably damaging 1.00
R7157:Olfr1076 UTSW 2 86509025 missense probably damaging 0.99
R7555:Olfr1076 UTSW 2 86509347 missense probably damaging 0.99
R7611:Olfr1076 UTSW 2 86509053 missense possibly damaging 0.84
R7640:Olfr1076 UTSW 2 86508943 missense possibly damaging 0.90
R7724:Olfr1076 UTSW 2 86508605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGTCTGCAATGTCTTATGACTG -3'
(R):5'- CACTGTCAGATGAGACCCAC -3'

Sequencing Primer
(F):5'- GACTGGTATGTCGCCATCTGTAAAC -3'
(R):5'- CAAGTGGAGAAAGCCTTCTGCC -3'
Posted On2015-06-20