Incidental Mutation 'R4259:Gpr171'
ID322556
Institutional Source Beutler Lab
Gene Symbol Gpr171
Ensembl Gene ENSMUSG00000050075
Gene NameG protein-coupled receptor 171
SynonymsF730001G15Rik, H963
MMRRC Submission 041072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4259 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59096448-59101821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59097527 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 276 (S276P)
Ref Sequence ENSEMBL: ENSMUSP00000082115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029393] [ENSMUST00000040325] [ENSMUST00000040846] [ENSMUST00000085040] [ENSMUST00000164225] [ENSMUST00000199659]
Predicted Effect probably benign
Transcript: ENSMUST00000029393
SMART Domains Protein: ENSMUSP00000029393
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 172 1.54e-17 SMART
low complexity region 227 235 N/A INTRINSIC
low complexity region 280 289 N/A INTRINSIC
Pfam:Med12-LCEWAV 293 737 1.6e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040846
SMART Domains Protein: ENSMUSP00000041859
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 172 1.54e-17 SMART
low complexity region 227 235 N/A INTRINSIC
low complexity region 280 289 N/A INTRINSIC
Pfam:Med12-LCEWAV 293 728 9e-201 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085040
AA Change: S276P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082115
Gene: ENSMUSG00000050075
AA Change: S276P

DomainStartEndE-ValueType
Pfam:7tm_1 31 285 4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Meta Mutation Damage Score 0.2556 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Cd248 A G 19: 5,068,838 D238G probably damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cyp2b19 G A 7: 26,763,382 G230S probably damaging Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Hap1 C A 11: 100,351,842 probably null Het
Hcn1 A T 13: 117,975,348 K616M unknown Het
Igkv4-90 T C 6: 68,807,477 I18M possibly damaging Het
Itpr3 T A 17: 27,106,324 V1297E probably damaging Het
Kmt2b T C 7: 30,581,081 N1319D probably damaging Het
Krt72 T C 15: 101,778,257 E418G probably damaging Het
Lama1 T C 17: 67,752,418 S599P possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrk1 A T 7: 66,330,764 Y223N probably damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr150 A T 9: 39,737,703 D296V probably damaging Het
Olfr480 T A 7: 108,065,893 K272* probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pdk2 T C 11: 95,041,144 D38G probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Prl3b1 T C 13: 27,243,906 probably null Het
Sat1 T C X: 155,215,186 probably benign Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc26a1 T A 5: 108,672,630 K250N probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Tbc1d32 A G 10: 56,049,771 S1093P probably damaging Het
Other mutations in Gpr171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:Gpr171 APN 3 59098151 missense probably damaging 1.00
IGL02635:Gpr171 APN 3 59097596 missense probably benign 0.04
IGL02858:Gpr171 APN 3 59097867 missense probably benign 0.26
R1491:Gpr171 UTSW 3 59097595 missense probably benign 0.01
R1539:Gpr171 UTSW 3 59097721 missense possibly damaging 0.50
R1819:Gpr171 UTSW 3 59097920 missense probably benign 0.02
R2255:Gpr171 UTSW 3 59098207 missense probably benign 0.01
R3721:Gpr171 UTSW 3 59097670 missense possibly damaging 0.95
R3856:Gpr171 UTSW 3 59098085 missense probably damaging 0.96
R4749:Gpr171 UTSW 3 59097466 missense probably benign 0.11
R4816:Gpr171 UTSW 3 59098096 missense probably damaging 1.00
R4972:Gpr171 UTSW 3 59097965 missense probably damaging 1.00
R6363:Gpr171 UTSW 3 59097892 missense possibly damaging 0.91
R6414:Gpr171 UTSW 3 59098123 missense probably damaging 0.97
R7076:Gpr171 UTSW 3 59098156 missense probably damaging 0.98
R7290:Gpr171 UTSW 3 59097726 missense probably benign 0.00
R7404:Gpr171 UTSW 3 59098201 missense probably damaging 0.99
R7447:Gpr171 UTSW 3 59098439 critical splice acceptor site probably null
R7721:Gpr171 UTSW 3 59097899 missense probably benign 0.40
R8120:Gpr171 UTSW 3 59097985 missense probably damaging 0.96
R8548:Gpr171 UTSW 3 59097979 missense probably damaging 1.00
R8897:Gpr171 UTSW 3 59097695 missense not run
Predicted Primers PCR Primer
(F):5'- GGTGGCTCTTATTCCTAAGCATC -3'
(R):5'- TGTGAAATCAGCTCTGCTCC -3'

Sequencing Primer
(F):5'- CCAGCTTTATGGTCCAGTCAGG -3'
(R):5'- CACATTCTCTTGGTGACAGCTAG -3'
Posted On2015-06-20