Incidental Mutation 'R4259:Fam71f1'
ID322558
Institutional Source Beutler Lab
Gene Symbol Fam71f1
Ensembl Gene ENSMUSG00000039742
Gene Namefamily with sequence similarity 71, member F1
SynonymsLOC330277
MMRRC Submission 041072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4259 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29319140-29336019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 29320801 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 141 (I141M)
Ref Sequence ENSEMBL: ENSMUSP00000126496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090487] [ENSMUST00000163229] [ENSMUST00000164560] [ENSMUST00000166462]
Predicted Effect probably damaging
Transcript: ENSMUST00000090487
AA Change: I141M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087973
Gene: ENSMUSG00000039742
AA Change: I141M

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Pfam:DUF3699 136 210 5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163229
SMART Domains Protein: ENSMUSP00000132402
Gene: ENSMUSG00000039742

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164560
AA Change: I141M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126496
Gene: ENSMUSG00000039742
AA Change: I141M

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Pfam:DUF3699 137 208 7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166462
AA Change: I141M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132703
Gene: ENSMUSG00000039742
AA Change: I141M

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Pfam:DUF3699 136 210 3.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171782
Meta Mutation Damage Score 0.2540 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Cd248 A G 19: 5,068,838 D238G probably damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cyp2b19 G A 7: 26,763,382 G230S probably damaging Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Gpr171 A G 3: 59,097,527 S276P probably damaging Het
Hap1 C A 11: 100,351,842 probably null Het
Hcn1 A T 13: 117,975,348 K616M unknown Het
Igkv4-90 T C 6: 68,807,477 I18M possibly damaging Het
Itpr3 T A 17: 27,106,324 V1297E probably damaging Het
Kmt2b T C 7: 30,581,081 N1319D probably damaging Het
Krt72 T C 15: 101,778,257 E418G probably damaging Het
Lama1 T C 17: 67,752,418 S599P possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrk1 A T 7: 66,330,764 Y223N probably damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr150 A T 9: 39,737,703 D296V probably damaging Het
Olfr480 T A 7: 108,065,893 K272* probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pdk2 T C 11: 95,041,144 D38G probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Prl3b1 T C 13: 27,243,906 probably null Het
Sat1 T C X: 155,215,186 probably benign Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc26a1 T A 5: 108,672,630 K250N probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Tbc1d32 A G 10: 56,049,771 S1093P probably damaging Het
Other mutations in Fam71f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Fam71f1 APN 6 29320701 missense probably damaging 0.99
IGL02342:Fam71f1 APN 6 29323830 missense possibly damaging 0.87
R0402:Fam71f1 UTSW 6 29323902 missense probably benign 0.01
R0467:Fam71f1 UTSW 6 29326607 missense probably damaging 1.00
R0610:Fam71f1 UTSW 6 29326577 missense probably benign 0.01
R1773:Fam71f1 UTSW 6 29334153 missense possibly damaging 0.83
R1950:Fam71f1 UTSW 6 29335816 utr 3 prime probably null
R4305:Fam71f1 UTSW 6 29326612 missense probably damaging 1.00
R4351:Fam71f1 UTSW 6 29320801 missense probably damaging 1.00
R4508:Fam71f1 UTSW 6 29323765 missense probably benign 0.04
R5014:Fam71f1 UTSW 6 29326724 intron probably benign
R5249:Fam71f1 UTSW 6 29323897 missense probably damaging 1.00
R5506:Fam71f1 UTSW 6 29319298 missense probably damaging 1.00
R6212:Fam71f1 UTSW 6 29319374 missense probably damaging 1.00
R6456:Fam71f1 UTSW 6 29334046 missense probably benign
R6949:Fam71f1 UTSW 6 29323906 missense probably damaging 1.00
R7047:Fam71f1 UTSW 6 29323810 missense probably damaging 1.00
R7562:Fam71f1 UTSW 6 29323834 missense probably damaging 1.00
X0065:Fam71f1 UTSW 6 29326661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATTGCAGGTCAGAAGG -3'
(R):5'- CTCAGGTTACTGCGGTCTAGAG -3'

Sequencing Primer
(F):5'- CATTGCAGGTCAGAAGGAGCAG -3'
(R):5'- AGGCCAGCCTTTACTGCATAATG -3'
Posted On2015-06-20