Incidental Mutation 'R4259:Cyp2b19'
ID322560
Institutional Source Beutler Lab
Gene Symbol Cyp2b19
Ensembl Gene ENSMUSG00000066704
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 19
Synonyms
MMRRC Submission 041072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4259 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26757142-26772630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26763382 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 230 (G230S)
Ref Sequence ENSEMBL: ENSMUSP00000077021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077855]
Predicted Effect probably damaging
Transcript: ENSMUST00000077855
AA Change: G230S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077021
Gene: ENSMUSG00000066704
AA Change: G230S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:p450 32 489 8.7e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138018
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Cd248 A G 19: 5,068,838 D238G probably damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gpr171 A G 3: 59,097,527 S276P probably damaging Het
Hap1 C A 11: 100,351,842 probably null Het
Hcn1 A T 13: 117,975,348 K616M unknown Het
Igkv4-90 T C 6: 68,807,477 I18M possibly damaging Het
Itpr3 T A 17: 27,106,324 V1297E probably damaging Het
Kmt2b T C 7: 30,581,081 N1319D probably damaging Het
Krt72 T C 15: 101,778,257 E418G probably damaging Het
Lama1 T C 17: 67,752,418 S599P possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrk1 A T 7: 66,330,764 Y223N probably damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr150 A T 9: 39,737,703 D296V probably damaging Het
Olfr480 T A 7: 108,065,893 K272* probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pdk2 T C 11: 95,041,144 D38G probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Prl3b1 T C 13: 27,243,906 probably null Het
Sat1 T C X: 155,215,186 probably benign Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc26a1 T A 5: 108,672,630 K250N probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Tbc1d32 A G 10: 56,049,771 S1093P probably damaging Het
Other mutations in Cyp2b19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cyp2b19 APN 7 26763461 missense possibly damaging 0.91
IGL01338:Cyp2b19 APN 7 26759417 missense probably benign 0.09
IGL01374:Cyp2b19 APN 7 26759079 missense probably benign 0.06
IGL01613:Cyp2b19 APN 7 26763461 missense possibly damaging 0.91
IGL01695:Cyp2b19 APN 7 26759064 missense probably damaging 1.00
IGL02322:Cyp2b19 APN 7 26762378 missense possibly damaging 0.79
IGL03077:Cyp2b19 APN 7 26762384 missense probably benign
R0047:Cyp2b19 UTSW 7 26766826 missense probably benign 0.01
R0047:Cyp2b19 UTSW 7 26766826 missense probably benign 0.01
R0452:Cyp2b19 UTSW 7 26766762 missense probably benign 0.01
R0865:Cyp2b19 UTSW 7 26762229 splice site probably benign
R1514:Cyp2b19 UTSW 7 26767160 missense probably benign 0.00
R1681:Cyp2b19 UTSW 7 26763340 splice site probably null
R2362:Cyp2b19 UTSW 7 26764377 missense probably damaging 1.00
R4015:Cyp2b19 UTSW 7 26762343 missense probably damaging 1.00
R4592:Cyp2b19 UTSW 7 26771394 missense probably benign 0.04
R4705:Cyp2b19 UTSW 7 26757292 missense probably benign 0.03
R4789:Cyp2b19 UTSW 7 26764376 missense probably benign 0.16
R5481:Cyp2b19 UTSW 7 26766821 missense probably damaging 0.99
R5749:Cyp2b19 UTSW 7 26763419 missense possibly damaging 0.84
R6041:Cyp2b19 UTSW 7 26759427 missense probably damaging 1.00
R6170:Cyp2b19 UTSW 7 26759094 missense possibly damaging 0.80
R6259:Cyp2b19 UTSW 7 26771392 missense possibly damaging 0.91
R6370:Cyp2b19 UTSW 7 26763358 missense probably benign 0.07
R6519:Cyp2b19 UTSW 7 26759111 missense probably benign
R6656:Cyp2b19 UTSW 7 26766855 missense probably benign
R7283:Cyp2b19 UTSW 7 26766914 missense probably damaging 1.00
R7583:Cyp2b19 UTSW 7 26759064 missense probably damaging 1.00
R7686:Cyp2b19 UTSW 7 26762343 missense probably damaging 1.00
R7732:Cyp2b19 UTSW 7 26771344 missense possibly damaging 0.67
R7831:Cyp2b19 UTSW 7 26767140 missense possibly damaging 0.80
R8035:Cyp2b19 UTSW 7 26771250 missense probably damaging 1.00
R8853:Cyp2b19 UTSW 7 26757220 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGACAGTTTGGCAAAGGGAC -3'
(R):5'- TCTGACAACATCCCCATCCT -3'

Sequencing Primer
(F):5'- CAGTTCAAAAGCATGCATGTGTATGG -3'
(R):5'- GACAACATCCCCATCCTTCACTTTC -3'
Posted On2015-06-20