Incidental Mutation 'R4259:Sgo2b'
ID322566
Institutional Source Beutler Lab
Gene Symbol Sgo2b
Ensembl Gene ENSMUSG00000094443
Gene Nameshugoshin 2B
SynonymsSgol2b, Gm4975
MMRRC Submission 041072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4259 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location63924694-63952248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63928296 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 501 (F501I)
Ref Sequence ENSEMBL: ENSMUSP00000136323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179944]
Predicted Effect probably benign
Transcript: ENSMUST00000179944
AA Change: F501I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000136323
Gene: ENSMUSG00000094443
AA Change: F501I

DomainStartEndE-ValueType
coiled coil region 54 113 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
internal_repeat_1 528 618 9.12e-8 PROSPERO
internal_repeat_1 713 809 9.12e-8 PROSPERO
low complexity region 1009 1024 N/A INTRINSIC
low complexity region 1059 1081 N/A INTRINSIC
low complexity region 1112 1126 N/A INTRINSIC
low complexity region 1130 1148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210915
Meta Mutation Damage Score 0.1685 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Cd248 A G 19: 5,068,838 D238G probably damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cyp2b19 G A 7: 26,763,382 G230S probably damaging Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gpr171 A G 3: 59,097,527 S276P probably damaging Het
Hap1 C A 11: 100,351,842 probably null Het
Hcn1 A T 13: 117,975,348 K616M unknown Het
Igkv4-90 T C 6: 68,807,477 I18M possibly damaging Het
Itpr3 T A 17: 27,106,324 V1297E probably damaging Het
Kmt2b T C 7: 30,581,081 N1319D probably damaging Het
Krt72 T C 15: 101,778,257 E418G probably damaging Het
Lama1 T C 17: 67,752,418 S599P possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrk1 A T 7: 66,330,764 Y223N probably damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr150 A T 9: 39,737,703 D296V probably damaging Het
Olfr480 T A 7: 108,065,893 K272* probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pdk2 T C 11: 95,041,144 D38G probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Prl3b1 T C 13: 27,243,906 probably null Het
Sat1 T C X: 155,215,186 probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc26a1 T A 5: 108,672,630 K250N probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Tbc1d32 A G 10: 56,049,771 S1093P probably damaging Het
Other mutations in Sgo2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sgo2b APN 8 63926523 missense probably benign
IGL01343:Sgo2b APN 8 63927315 nonsense probably null
IGL02027:Sgo2b APN 8 63926829 missense probably benign
IGL02090:Sgo2b APN 8 63927089 missense probably damaging 0.99
IGL02121:Sgo2b APN 8 63931282 missense possibly damaging 0.94
IGL02206:Sgo2b APN 8 63941084 missense possibly damaging 0.94
IGL02554:Sgo2b APN 8 63926537 missense probably damaging 0.96
IGL02663:Sgo2b APN 8 63943114 missense probably damaging 0.97
IGL03149:Sgo2b APN 8 63926583 missense probably benign 0.14
floater UTSW 8 63938417 nonsense probably null
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0201:Sgo2b UTSW 8 63926636 missense probably benign
R0285:Sgo2b UTSW 8 63928789 nonsense probably null
R0325:Sgo2b UTSW 8 63928376 missense probably benign 0.20
R0727:Sgo2b UTSW 8 63927782 missense probably damaging 0.98
R0943:Sgo2b UTSW 8 63931335 missense possibly damaging 0.82
R1148:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1266:Sgo2b UTSW 8 63928421 missense probably benign 0.00
R1484:Sgo2b UTSW 8 63931473 missense possibly damaging 0.77
R1493:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1537:Sgo2b UTSW 8 63926502 missense possibly damaging 0.94
R1630:Sgo2b UTSW 8 63927797 missense possibly damaging 0.90
R1803:Sgo2b UTSW 8 63927392 missense probably benign 0.01
R1912:Sgo2b UTSW 8 63931469 missense probably damaging 0.98
R1993:Sgo2b UTSW 8 63926833 missense probably benign 0.36
R2042:Sgo2b UTSW 8 63928527 missense probably benign
R2130:Sgo2b UTSW 8 63927147 missense probably benign 0.09
R2146:Sgo2b UTSW 8 63928023 missense probably benign 0.00
R2881:Sgo2b UTSW 8 63927536 missense probably damaging 0.99
R3686:Sgo2b UTSW 8 63931327 missense probably benign 0.20
R3706:Sgo2b UTSW 8 63928145 missense probably damaging 0.98
R3889:Sgo2b UTSW 8 63927743 missense possibly damaging 0.82
R3894:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R3895:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R4058:Sgo2b UTSW 8 63926947 missense probably damaging 0.98
R4260:Sgo2b UTSW 8 63928296 missense probably benign 0.06
R4704:Sgo2b UTSW 8 63927790 missense probably damaging 0.98
R4815:Sgo2b UTSW 8 63931414 missense probably benign
R4922:Sgo2b UTSW 8 63926630 missense possibly damaging 0.66
R5232:Sgo2b UTSW 8 63928602 missense possibly damaging 0.55
R5262:Sgo2b UTSW 8 63943137 missense probably damaging 0.99
R5444:Sgo2b UTSW 8 63926556 missense possibly damaging 0.90
R5677:Sgo2b UTSW 8 63926974 missense possibly damaging 0.77
R5959:Sgo2b UTSW 8 63927288 missense probably benign 0.01
R6004:Sgo2b UTSW 8 63926673 nonsense probably null
R6267:Sgo2b UTSW 8 63927793 missense probably benign
R6296:Sgo2b UTSW 8 63927793 missense probably benign
R6328:Sgo2b UTSW 8 63928311 nonsense probably null
R6517:Sgo2b UTSW 8 63931494 missense probably damaging 0.99
R6523:Sgo2b UTSW 8 63927504 missense probably benign 0.11
R6726:Sgo2b UTSW 8 63927735 nonsense probably null
R6957:Sgo2b UTSW 8 63931455 small deletion probably benign
R7031:Sgo2b UTSW 8 63940044 missense possibly damaging 0.94
R7034:Sgo2b UTSW 8 63926834 missense probably benign 0.36
R7145:Sgo2b UTSW 8 63928184 missense probably damaging 1.00
R7289:Sgo2b UTSW 8 63941158 missense probably damaging 0.97
R7366:Sgo2b UTSW 8 63938417 nonsense probably null
R7660:Sgo2b UTSW 8 63940074 missense probably benign 0.27
R7761:Sgo2b UTSW 8 63926912 missense probably benign
R7762:Sgo2b UTSW 8 63926497 missense probably benign 0.03
R7822:Sgo2b UTSW 8 63927284 missense probably damaging 0.98
R8111:Sgo2b UTSW 8 63943104 missense probably damaging 0.98
R8129:Sgo2b UTSW 8 63928800 missense possibly damaging 0.90
RF014:Sgo2b UTSW 8 63931405 missense possibly damaging 0.94
RF055:Sgo2b UTSW 8 63943169 missense probably damaging 1.00
Z1088:Sgo2b UTSW 8 63927005 missense probably damaging 1.00
Z1088:Sgo2b UTSW 8 63928422 missense possibly damaging 0.61
Z1177:Sgo2b UTSW 8 63927439 missense probably benign 0.03
Z1177:Sgo2b UTSW 8 63928385 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGCCCAATGTTGTCTGAGCC -3'
(R):5'- GAGCCAAACTGTATTTCCAGTACTG -3'

Sequencing Primer
(F):5'- TGAGCCTCATGGTCACATAC -3'
(R):5'- ACTGTATTTCCAGTACTGAGCAGC -3'
Posted On2015-06-20