Incidental Mutation 'R4259:Olfr150'
ID322567
Institutional Source Beutler Lab
Gene Symbol Olfr150
Ensembl Gene ENSMUSG00000094353
Gene Nameolfactory receptor 150
SynonymsGA_x6K02T2PVTD-33434302-33435240, MOR171-18, M93
MMRRC Submission 041072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4259 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39730978-39738456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39737703 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 296 (D296V)
Ref Sequence ENSEMBL: ENSMUSP00000150024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078557] [ENSMUST00000217257]
Predicted Effect probably damaging
Transcript: ENSMUST00000078557
AA Change: D296V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077635
Gene: ENSMUSG00000094353
AA Change: D296V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-50 PFAM
Pfam:7tm_1 41 290 1.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217257
AA Change: D296V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Cd248 A G 19: 5,068,838 D238G probably damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cyp2b19 G A 7: 26,763,382 G230S probably damaging Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gpr171 A G 3: 59,097,527 S276P probably damaging Het
Hap1 C A 11: 100,351,842 probably null Het
Hcn1 A T 13: 117,975,348 K616M unknown Het
Igkv4-90 T C 6: 68,807,477 I18M possibly damaging Het
Itpr3 T A 17: 27,106,324 V1297E probably damaging Het
Kmt2b T C 7: 30,581,081 N1319D probably damaging Het
Krt72 T C 15: 101,778,257 E418G probably damaging Het
Lama1 T C 17: 67,752,418 S599P possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrk1 A T 7: 66,330,764 Y223N probably damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr480 T A 7: 108,065,893 K272* probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pdk2 T C 11: 95,041,144 D38G probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Prl3b1 T C 13: 27,243,906 probably null Het
Sat1 T C X: 155,215,186 probably benign Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc26a1 T A 5: 108,672,630 K250N probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Tbc1d32 A G 10: 56,049,771 S1093P probably damaging Het
Other mutations in Olfr150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Olfr150 APN 9 39737499 missense probably damaging 1.00
IGL01110:Olfr150 APN 9 39737397 missense probably benign 0.00
IGL01343:Olfr150 APN 9 39737715 missense probably damaging 0.99
IGL01942:Olfr150 APN 9 39737666 missense possibly damaging 0.90
IGL02044:Olfr150 APN 9 39736974 missense possibly damaging 0.94
PIT4486001:Olfr150 UTSW 9 39737239 nonsense probably null
R1178:Olfr150 UTSW 9 39737346 missense probably damaging 1.00
R1451:Olfr150 UTSW 9 39737316 missense probably benign 0.00
R1672:Olfr150 UTSW 9 39737196 missense probably damaging 1.00
R1916:Olfr150 UTSW 9 39737622 missense probably benign 0.06
R2095:Olfr150 UTSW 9 39737261 missense probably damaging 0.98
R2116:Olfr150 UTSW 9 39737304 missense probably damaging 0.98
R4183:Olfr150 UTSW 9 39737048 missense probably benign 0.01
R4590:Olfr150 UTSW 9 39736850 missense probably damaging 1.00
R5188:Olfr150 UTSW 9 39737235 missense probably benign 0.00
R6158:Olfr150 UTSW 9 39737076 missense probably benign
R6361:Olfr150 UTSW 9 39737672 missense probably damaging 1.00
R6807:Olfr150 UTSW 9 39737618 nonsense probably null
R6977:Olfr150 UTSW 9 39737034 missense probably benign 0.01
R7412:Olfr150 UTSW 9 39737126 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AGGGCAGATTCAAAGCCTTC -3'
(R):5'- TGTGTAAACCCATTCCTCACTG -3'

Sequencing Primer
(F):5'- GCCTTCAGCACATGTAGCTC -3'
(R):5'- CTCTGTACATGTTCCTAAACA -3'
Posted On2015-06-20