Incidental Mutation 'R4259:Slc5a4b'
ID322569
Institutional Source Beutler Lab
Gene Symbol Slc5a4b
Ensembl Gene ENSMUSG00000020226
Gene Namesolute carrier family 5 (neutral amino acid transporters, system A), member 4b
SynonymspSGLT2, SGLT3b, 2010104G07Rik, SAAT1
MMRRC Submission 041072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4259 (G1)
Quality Score211
Status Validated
Chromosome10
Chromosomal Location76057494-76110961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76103852 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 150 (L150P)
Ref Sequence ENSEMBL: ENSMUSP00000113582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120757]
Predicted Effect probably damaging
Transcript: ENSMUST00000120757
AA Change: L150P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113582
Gene: ENSMUSG00000020226
AA Change: L150P

DomainStartEndE-ValueType
low complexity region 16 21 N/A INTRINSIC
Pfam:SSF 58 492 1.4e-163 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 640 659 N/A INTRINSIC
Meta Mutation Damage Score 0.9413 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Cd248 A G 19: 5,068,838 D238G probably damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cyp2b19 G A 7: 26,763,382 G230S probably damaging Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gpr171 A G 3: 59,097,527 S276P probably damaging Het
Hap1 C A 11: 100,351,842 probably null Het
Hcn1 A T 13: 117,975,348 K616M unknown Het
Igkv4-90 T C 6: 68,807,477 I18M possibly damaging Het
Itpr3 T A 17: 27,106,324 V1297E probably damaging Het
Kmt2b T C 7: 30,581,081 N1319D probably damaging Het
Krt72 T C 15: 101,778,257 E418G probably damaging Het
Lama1 T C 17: 67,752,418 S599P possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrk1 A T 7: 66,330,764 Y223N probably damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr150 A T 9: 39,737,703 D296V probably damaging Het
Olfr480 T A 7: 108,065,893 K272* probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pdk2 T C 11: 95,041,144 D38G probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Prl3b1 T C 13: 27,243,906 probably null Het
Sat1 T C X: 155,215,186 probably benign Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc26a1 T A 5: 108,672,630 K250N probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Tbc1d32 A G 10: 56,049,771 S1093P probably damaging Het
Other mutations in Slc5a4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Slc5a4b APN 10 76070588 missense probably damaging 1.00
IGL01433:Slc5a4b APN 10 76070495 splice site probably benign
IGL01754:Slc5a4b APN 10 76070615 missense probably damaging 1.00
IGL01904:Slc5a4b APN 10 76060426 missense probably damaging 0.98
IGL01990:Slc5a4b APN 10 76060354 missense probably benign 0.01
IGL02211:Slc5a4b APN 10 76060463 splice site probably benign
IGL02254:Slc5a4b APN 10 76060430 missense probably benign
IGL02389:Slc5a4b APN 10 76072465 nonsense probably null
IGL02427:Slc5a4b APN 10 76058879 missense possibly damaging 0.47
IGL02493:Slc5a4b APN 10 76075015 missense probably damaging 1.00
IGL02554:Slc5a4b APN 10 76110851 missense possibly damaging 0.75
IGL02670:Slc5a4b APN 10 76075100 missense probably damaging 1.00
R0254:Slc5a4b UTSW 10 76070628 missense possibly damaging 0.55
R0285:Slc5a4b UTSW 10 76062283 missense probably damaging 0.99
R0294:Slc5a4b UTSW 10 76081327 missense probably damaging 1.00
R0522:Slc5a4b UTSW 10 76090700 missense probably damaging 0.99
R0601:Slc5a4b UTSW 10 76064036 missense possibly damaging 0.81
R0714:Slc5a4b UTSW 10 76081507 missense probably benign 0.09
R0975:Slc5a4b UTSW 10 76081407 missense probably benign 0.09
R1934:Slc5a4b UTSW 10 76081473 missense possibly damaging 0.51
R2339:Slc5a4b UTSW 10 76108549 missense probably damaging 1.00
R2886:Slc5a4b UTSW 10 76075073 missense probably damaging 0.98
R3552:Slc5a4b UTSW 10 76081524 missense probably damaging 0.99
R3890:Slc5a4b UTSW 10 76062260 missense probably benign 0.01
R4012:Slc5a4b UTSW 10 76074992 missense probably damaging 1.00
R4260:Slc5a4b UTSW 10 76103852 missense probably damaging 1.00
R4471:Slc5a4b UTSW 10 76058891 nonsense probably null
R4667:Slc5a4b UTSW 10 76075045 missense possibly damaging 0.78
R4846:Slc5a4b UTSW 10 76062239 missense probably damaging 0.99
R4939:Slc5a4b UTSW 10 76081467 missense probably benign 0.44
R5181:Slc5a4b UTSW 10 76060387 nonsense probably null
R5319:Slc5a4b UTSW 10 76062399 missense probably benign 0.08
R6306:Slc5a4b UTSW 10 76081351 missense probably benign 0.01
R6422:Slc5a4b UTSW 10 76103862 missense probably damaging 0.97
R6837:Slc5a4b UTSW 10 76062386 missense possibly damaging 0.49
R6997:Slc5a4b UTSW 10 76089978 missense probably damaging 0.97
R7140:Slc5a4b UTSW 10 76075109 missense probably damaging 1.00
R7527:Slc5a4b UTSW 10 76110908 missense probably benign 0.01
R7683:Slc5a4b UTSW 10 76064072 missense probably damaging 0.96
R7718:Slc5a4b UTSW 10 76070573 missense probably damaging 1.00
R7794:Slc5a4b UTSW 10 76062299 missense probably benign 0.19
R7877:Slc5a4b UTSW 10 76075052 missense probably damaging 1.00
R8150:Slc5a4b UTSW 10 76103846 missense possibly damaging 0.93
X0019:Slc5a4b UTSW 10 76110851 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCCAGTCTTCATAGCTGGAGG -3'
(R):5'- CATGGAACTGCATCTTTCTCAC -3'

Sequencing Primer
(F):5'- GCTAGTAGGGTTAGATGGCTTATAC -3'
(R):5'- CCACAGACTATGCAAGGGTTTTG -3'
Posted On2015-06-20