Mutagenetix > Incidental Mutations

Incidental Mutation 'R4259:Slc5a4b'

322569

Institutional Source

Beutler Lab

Gene Symbol

Slc5a4b

Ensembl Gene

ENSMUSG00000020226

Gene Name

solute carrier family 5 (neutral amino acid transporters, system A), member 4b

Synonyms

pSGLT2, SGLT3b, 2010104G07Rik, SAAT1

MMRRC Submission

041072-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.115) question?

Stock #

R4259 (G1)

Quality Score

211

Status

Validated

Chromosome

Chromosomal Location

76057494-76110961 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76103852 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 150 (L150P)

Ref Sequence

ENSEMBL: ENSMUSP00000113582 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120757]

Predicted Effect

probably damaging
Transcript: ENSMUST00000120757
AA Change: L150P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113582
Gene: ENSMUSG00000020226
AA Change: L150P

Domain	Start	End	E-Value	Type
low complexity region	16	21	N/A	INTRINSIC
Pfam:SSF	58	492	1.4e-163	PFAM
transmembrane domain	526	548	N/A	INTRINSIC
transmembrane domain	640	659	N/A	INTRINSIC

Meta Mutation Damage Score

0.9413

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (40/41)

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	C	17: 8,995,234	S298P	probably damaging	Het
4930407I10Rik	A	G	15: 82,063,726	D608G	possibly damaging	Het
Actr10	T	C	12: 70,952,985	V185A	probably benign	Het
Cd248	A	G	19: 5,068,838	D238G	probably damaging	Het
Cep290	A	C	10: 100,514,492	E649D	probably damaging	Het
Cyp2b19	G	A	7: 26,763,382	G230S	probably damaging	Het
Dnah12	A	G	14: 26,798,926	I1901V	probably benign	Het
Fam71f1	C	G	6: 29,320,801	I141M	probably damaging	Het
Gpr171	A	G	3: 59,097,527	S276P	probably damaging	Het
Hap1	C	A	11: 100,351,842		probably null	Het
Hcn1	A	T	13: 117,975,348	K616M	unknown	Het
Igkv4-90	T	C	6: 68,807,477	I18M	possibly damaging	Het
Itpr3	T	A	17: 27,106,324	V1297E	probably damaging	Het
Kmt2b	T	C	7: 30,581,081	N1319D	probably damaging	Het
Krt72	T	C	15: 101,778,257	E418G	probably damaging	Het
Lama1	T	C	17: 67,752,418	S599P	possibly damaging	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Lrrk1	A	T	7: 66,330,764	Y223N	probably damaging	Het
Olfr1076	A	G	2: 86,508,999	D180G	probably damaging	Het
Olfr150	A	T	9: 39,737,703	D296V	probably damaging	Het
Olfr480	T	A	7: 108,065,893	K272*	probably null	Het
Pde6c	G	A	19: 38,162,845	G608S	probably damaging	Het
Pdgfrb	A	C	18: 61,077,631	T737P	probably benign	Het
Pdk2	T	C	11: 95,041,144	D38G	probably benign	Het
Pgk2	T	G	17: 40,207,383	T385P	probably benign	Het
Prl3b1	T	C	13: 27,243,906		probably null	Het
Sat1	T	C	X: 155,215,186		probably benign	Het
Sgo2b	A	T	8: 63,928,296	F501I	probably benign	Het
Sgsm2	T	A	11: 74,892,028	H34L	probably damaging	Het
Slc26a1	T	A	5: 108,672,630	K250N	probably damaging	Het
Slc38a4	A	G	15: 96,998,493	Y498H	probably damaging	Het
Tbc1d32	A	G	10: 56,049,771	S1093P	probably damaging	Het

Other mutations in Slc5a4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01348:Slc5a4b	APN	10	76070588	missense	probably damaging	1.00
IGL01433:Slc5a4b	APN	10	76070495	splice site	probably benign
IGL01754:Slc5a4b	APN	10	76070615	missense	probably damaging	1.00
IGL01904:Slc5a4b	APN	10	76060426	missense	probably damaging	0.98
IGL01990:Slc5a4b	APN	10	76060354	missense	probably benign	0.01
IGL02211:Slc5a4b	APN	10	76060463	splice site	probably benign
IGL02254:Slc5a4b	APN	10	76060430	missense	probably benign
IGL02389:Slc5a4b	APN	10	76072465	nonsense	probably null
IGL02427:Slc5a4b	APN	10	76058879	missense	possibly damaging	0.47
IGL02493:Slc5a4b	APN	10	76075015	missense	probably damaging	1.00
IGL02554:Slc5a4b	APN	10	76110851	missense	possibly damaging	0.75
IGL02670:Slc5a4b	APN	10	76075100	missense	probably damaging	1.00
R0254:Slc5a4b	UTSW	10	76070628	missense	possibly damaging	0.55
R0285:Slc5a4b	UTSW	10	76062283	missense	probably damaging	0.99
R0294:Slc5a4b	UTSW	10	76081327	missense	probably damaging	1.00
R0522:Slc5a4b	UTSW	10	76090700	missense	probably damaging	0.99
R0601:Slc5a4b	UTSW	10	76064036	missense	possibly damaging	0.81
R0714:Slc5a4b	UTSW	10	76081507	missense	probably benign	0.09
R0975:Slc5a4b	UTSW	10	76081407	missense	probably benign	0.09
R1934:Slc5a4b	UTSW	10	76081473	missense	possibly damaging	0.51
R2339:Slc5a4b	UTSW	10	76108549	missense	probably damaging	1.00
R2886:Slc5a4b	UTSW	10	76075073	missense	probably damaging	0.98
R3552:Slc5a4b	UTSW	10	76081524	missense	probably damaging	0.99
R3890:Slc5a4b	UTSW	10	76062260	missense	probably benign	0.01
R4012:Slc5a4b	UTSW	10	76074992	missense	probably damaging	1.00
R4260:Slc5a4b	UTSW	10	76103852	missense	probably damaging	1.00
R4471:Slc5a4b	UTSW	10	76058891	nonsense	probably null
R4667:Slc5a4b	UTSW	10	76075045	missense	possibly damaging	0.78
R4846:Slc5a4b	UTSW	10	76062239	missense	probably damaging	0.99
R4939:Slc5a4b	UTSW	10	76081467	missense	probably benign	0.44
R5181:Slc5a4b	UTSW	10	76060387	nonsense	probably null
R5319:Slc5a4b	UTSW	10	76062399	missense	probably benign	0.08
R6306:Slc5a4b	UTSW	10	76081351	missense	probably benign	0.01
R6422:Slc5a4b	UTSW	10	76103862	missense	probably damaging	0.97
R6837:Slc5a4b	UTSW	10	76062386	missense	possibly damaging	0.49
R6997:Slc5a4b	UTSW	10	76089978	missense	probably damaging	0.97
R7140:Slc5a4b	UTSW	10	76075109	missense	probably damaging	1.00
R7527:Slc5a4b	UTSW	10	76110908	missense	probably benign	0.01
R7683:Slc5a4b	UTSW	10	76064072	missense	probably damaging	0.96
R7718:Slc5a4b	UTSW	10	76070573	missense	probably damaging	1.00
R7794:Slc5a4b	UTSW	10	76062299	missense	probably benign	0.19
R7877:Slc5a4b	UTSW	10	76075052	missense	probably damaging	1.00
R8150:Slc5a4b	UTSW	10	76103846	missense	possibly damaging	0.93
X0019:Slc5a4b	UTSW	10	76110851	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- TCCAGTCTTCATAGCTGGAGG -3'
(R):5'- CATGGAACTGCATCTTTCTCAC -3'

Sequencing Primer
(F):5'- GCTAGTAGGGTTAGATGGCTTATAC -3'
(R):5'- CCACAGACTATGCAAGGGTTTTG -3'

Posted On

2015-06-20