Incidental Mutation 'R0001:Lig3'
ID32257
Institutional Source Beutler Lab
Gene Symbol Lig3
Ensembl Gene ENSMUSG00000020697
Gene Nameligase III, DNA, ATP-dependent
SynonymsD11Wsu78e
MMRRC Submission 038297-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0001 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82781108-82804274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82790591 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 470 (R470W)
Ref Sequence ENSEMBL: ENSMUSP00000133849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021039] [ENSMUST00000080461] [ENSMUST00000092849] [ENSMUST00000131537] [ENSMUST00000173009] [ENSMUST00000173347] [ENSMUST00000173722] [ENSMUST00000173727]
Predicted Effect probably damaging
Transcript: ENSMUST00000021039
AA Change: R475W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021039
Gene: ENSMUSG00000020697
AA Change: R475W

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 265 440 3.5e-34 PFAM
Pfam:DNA_ligase_A_M 489 683 3.9e-65 PFAM
Pfam:DNA_ligase_A_C 710 820 3.8e-21 PFAM
low complexity region 855 885 N/A INTRINSIC
BRCT 942 1010 9.77e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080461
AA Change: R471W

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079317
Gene: ENSMUSG00000020697
AA Change: R471W

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 6.8e-53 PFAM
Pfam:DNA_ligase_A_M 485 679 1.3e-63 PFAM
Pfam:DNA_ligase_A_C 706 816 3.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092849
AA Change: R471W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090525
Gene: ENSMUSG00000020697
AA Change: R471W

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131537
SMART Domains Protein: ENSMUSP00000133672
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 431 3.1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172609
Predicted Effect probably benign
Transcript: ENSMUST00000173009
SMART Domains Protein: ENSMUSP00000133348
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 431 3.1e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173347
AA Change: R470W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134300
Gene: ENSMUSG00000020697
AA Change: R470W

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173722
AA Change: R471W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133805
Gene: ENSMUSG00000020697
AA Change: R471W

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173727
AA Change: R470W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133849
Gene: ENSMUSG00000020697
AA Change: R470W

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA ligase family. Each member of this family encodes a protein that catalyzes the joining of DNA ends but they each have a distinct role in DNA metabolism. The protein encoded by this gene is involved in excision repair and is located in both the mitochondria and nucleus, with translation initiation from the upstream start codon allowing for transport to the mitochondria and translation initiation from a downstream start codon allowing for transport to the nucleus. Additionally, alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene causes embryonic growth arrest at 8.5 dpc, followed by excessive apoptosis at 9.5 dpc, and ultimately death, likely due to unrepaired DNA damage. Homozygous mutant cells display elevated sister chromatid exchange. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik G A 19: 58,789,171 A61V probably damaging Het
2900092C05Rik T A 7: 12,554,607 probably benign Het
A4galt A G 15: 83,228,289 F98L probably benign Het
Abca4 T G 3: 122,081,011 probably benign Het
Acacb C T 5: 114,204,833 probably benign Het
Agbl1 A T 7: 76,419,863 H367L probably damaging Het
Apoa4 C A 9: 46,242,892 Q264K probably benign Het
Camsap2 A T 1: 136,282,888 probably benign Het
Cdan1 C A 2: 120,723,751 R939L probably benign Het
Ceacam18 G A 7: 43,636,876 V58I possibly damaging Het
Ciita A T 16: 10,514,433 probably benign Het
Clk4 T A 11: 51,268,765 probably benign Het
Cntnap2 T C 6: 46,530,171 D215G probably benign Het
Col11a2 T C 17: 34,061,612 S1218P probably benign Het
Col20a1 T C 2: 180,984,412 probably benign Het
Ctsb A G 14: 63,135,622 E76G probably benign Het
Ctu2 T C 8: 122,478,920 C161R probably benign Het
Dhx29 T C 13: 112,964,556 L1211P probably damaging Het
Dhx9 G T 1: 153,462,636 T759K probably damaging Het
Dmxl1 T C 18: 49,888,897 probably benign Het
Dpysl3 C T 18: 43,358,375 E226K possibly damaging Het
Eif2d A T 1: 131,168,127 K453* probably null Het
Epha7 T C 4: 28,961,279 probably benign Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fat3 T C 9: 16,377,873 D118G probably damaging Het
Foxn4 T A 5: 114,260,870 Q159L probably damaging Het
Frs2 G T 10: 117,074,876 H194N possibly damaging Het
Fut8 A T 12: 77,475,315 *576L probably null Het
Galns T C 8: 122,595,883 probably benign Het
Gamt G A 10: 80,259,061 probably benign Het
Gpn1 T A 5: 31,495,617 probably benign Het
Ipcef1 G T 10: 6,900,600 H330Q probably damaging Het
Itga4 A C 2: 79,326,587 Y1024S probably damaging Het
Jak2 A G 19: 29,282,387 I229V probably benign Het
Katnal1 A G 5: 148,921,275 S42P probably damaging Het
Kcnu1 A T 8: 25,859,270 D142V probably damaging Het
Mgat4c A G 10: 102,388,956 S344G probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 C T 12: 57,460,839 probably benign Het
Mki67 C T 7: 135,699,172 V1378M probably damaging Het
Mki67 T A 7: 135,701,019 D762V probably damaging Het
Mmp9 A G 2: 164,948,383 T43A probably benign Het
Muc6 T C 7: 141,641,574 T1316A possibly damaging Het
Naip5 A G 13: 100,214,650 probably null Het
Naip5 C A 13: 100,223,114 S538I probably benign Het
Nek3 A T 8: 22,158,612 probably benign Het
Nlrp1b A G 11: 71,161,759 S948P probably damaging Het
Nyap2 A T 1: 81,192,107 H193L probably benign Het
Olfr1413 A G 1: 92,573,461 K97E possibly damaging Het
Olfr648 T A 7: 104,179,473 K312* probably null Het
Patl2 G A 2: 122,125,710 probably benign Het
Pcdhb11 A T 18: 37,423,989 R791W probably benign Het
Pkd1l3 C A 8: 109,628,633 probably benign Het
Pkn2 A T 3: 142,828,988 V73D probably benign Het
Pknox1 A T 17: 31,599,636 H281L probably damaging Het
Polr3a A G 14: 24,452,189 probably benign Het
Prss38 A G 11: 59,373,180 probably benign Het
Rad54l2 A G 9: 106,708,217 F783S probably damaging Het
Rbm5 T C 9: 107,742,424 R125G probably damaging Het
Rnpep A G 1: 135,272,485 probably benign Het
Slc1a5 T A 7: 16,793,637 probably null Het
Slc22a4 G A 11: 54,028,003 probably benign Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Svep1 G A 4: 58,066,460 T3208I possibly damaging Het
Tgm5 G T 2: 121,077,646 D16E probably damaging Het
Tpp2 A G 1: 43,971,726 N558D probably benign Het
Trappc9 A T 15: 72,963,662 L507Q probably damaging Het
Trpm3 A T 19: 22,715,331 Q262L possibly damaging Het
Ttn A G 2: 76,776,972 probably benign Het
Ttn G A 2: 76,832,089 probably benign Het
Ubr4 T A 4: 139,451,788 L3316Q probably damaging Het
Uckl1 T A 2: 181,574,655 Y136F probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps39 A G 2: 120,318,053 V870A probably benign Het
Zdhhc25 A G 15: 88,600,909 D149G probably benign Het
Zfp648 C T 1: 154,205,286 T397M probably damaging Het
Zic2 C A 14: 122,478,957 T435K probably damaging Het
Other mutations in Lig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Lig3 APN 11 82797315 missense possibly damaging 0.90
IGL01577:Lig3 APN 11 82783477 missense probably benign 0.00
IGL01643:Lig3 APN 11 82798292 missense probably damaging 1.00
IGL01712:Lig3 APN 11 82789541 splice site probably benign
IGL01724:Lig3 APN 11 82790622 missense possibly damaging 0.95
IGL01749:Lig3 APN 11 82789867 missense probably damaging 1.00
IGL01778:Lig3 APN 11 82794541 missense probably damaging 1.00
IGL02798:Lig3 APN 11 82795705 splice site probably benign
IGL03007:Lig3 APN 11 82789575 missense probably damaging 1.00
IGL03178:Lig3 APN 11 82789722 splice site probably benign
R0115:Lig3 UTSW 11 82793935 missense probably damaging 1.00
R0834:Lig3 UTSW 11 82798287 missense probably damaging 0.99
R1460:Lig3 UTSW 11 82795798 splice site probably benign
R1602:Lig3 UTSW 11 82792194 critical splice donor site probably null
R1969:Lig3 UTSW 11 82795718 missense probably benign 0.14
R1971:Lig3 UTSW 11 82795718 missense probably benign 0.14
R1997:Lig3 UTSW 11 82787666 missense probably benign 0.00
R3817:Lig3 UTSW 11 82796115 missense possibly damaging 0.75
R4083:Lig3 UTSW 11 82790494 missense probably benign 0.31
R4084:Lig3 UTSW 11 82795424 missense probably damaging 1.00
R4665:Lig3 UTSW 11 82800250 missense probably damaging 0.99
R4737:Lig3 UTSW 11 82787727 missense probably damaging 1.00
R5212:Lig3 UTSW 11 82787678 missense probably benign
R5274:Lig3 UTSW 11 82797292 splice site probably null
R6320:Lig3 UTSW 11 82794007 critical splice donor site probably null
R6807:Lig3 UTSW 11 82783751 missense probably benign 0.00
R7103:Lig3 UTSW 11 82797312 missense probably benign 0.17
R7552:Lig3 UTSW 11 82788891 missense probably benign 0.00
R7646:Lig3 UTSW 11 82783478 missense probably benign 0.00
R7910:Lig3 UTSW 11 82797775 missense probably damaging 0.99
R7991:Lig3 UTSW 11 82797775 missense probably damaging 0.99
R8001:Lig3 UTSW 11 82792076 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CAGACTGCTACCCTCAGCCATAATG -3'
(R):5'- CCTGTCTTCAGGTGTGAGGCTAAAC -3'

Sequencing Primer
(F):5'- CCTCAGCCATAATGTCAGATGTAGAG -3'
(R):5'- GGACTCAGGTTGTACTAAATCCC -3'
Posted On2013-05-09