Incidental Mutation 'R4259:Slc38a4'
ID322580
Institutional Source Beutler Lab
Gene Symbol Slc38a4
Ensembl Gene ENSMUSG00000022464
Gene Namesolute carrier family 38, member 4
Synonyms1700012A18Rik, Ata3, 1110012E16Rik
MMRRC Submission 041072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R4259 (G1)
Quality Score210
Status Validated
Chromosome15
Chromosomal Location96994820-97055956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96998493 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 498 (Y498H)
Ref Sequence ENSEMBL: ENSMUSP00000155158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023101] [ENSMUST00000166223] [ENSMUST00000230086] [ENSMUST00000231039]
Predicted Effect probably damaging
Transcript: ENSMUST00000023101
AA Change: Y498H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023101
Gene: ENSMUSG00000022464
AA Change: Y498H

DomainStartEndE-ValueType
Pfam:Aa_trans 73 263 4.9e-38 PFAM
Pfam:Aa_trans 302 535 2.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166223
AA Change: Y498H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127676
Gene: ENSMUSG00000022464
AA Change: Y498H

DomainStartEndE-ValueType
Pfam:Aa_trans 73 262 2.5e-38 PFAM
Pfam:Aa_trans 303 535 2.5e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000230086
AA Change: Y498H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231039
AA Change: Y498H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8773 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC38A4 is found predominantly in liver and transports both cationic and neutral amino acids. The transport of cationic amino acids by SLC38A4 is Na(+) and pH independent, while the transport of neutral amino acids is Na(+) and pH dependent (Hatanaka et al., 2001 [PubMed 11342143]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Cd248 A G 19: 5,068,838 D238G probably damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cyp2b19 G A 7: 26,763,382 G230S probably damaging Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gpr171 A G 3: 59,097,527 S276P probably damaging Het
Hap1 C A 11: 100,351,842 probably null Het
Hcn1 A T 13: 117,975,348 K616M unknown Het
Igkv4-90 T C 6: 68,807,477 I18M possibly damaging Het
Itpr3 T A 17: 27,106,324 V1297E probably damaging Het
Kmt2b T C 7: 30,581,081 N1319D probably damaging Het
Krt72 T C 15: 101,778,257 E418G probably damaging Het
Lama1 T C 17: 67,752,418 S599P possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrk1 A T 7: 66,330,764 Y223N probably damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr150 A T 9: 39,737,703 D296V probably damaging Het
Olfr480 T A 7: 108,065,893 K272* probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pdk2 T C 11: 95,041,144 D38G probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Prl3b1 T C 13: 27,243,906 probably null Het
Sat1 T C X: 155,215,186 probably benign Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc26a1 T A 5: 108,672,630 K250N probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Tbc1d32 A G 10: 56,049,771 S1093P probably damaging Het
Other mutations in Slc38a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Slc38a4 APN 15 97019809 missense probably benign 0.01
IGL00229:Slc38a4 APN 15 96999494 missense probably damaging 0.99
IGL00974:Slc38a4 APN 15 96999516 missense probably benign 0.05
IGL01951:Slc38a4 APN 15 97019763 missense probably benign 0.07
R0012:Slc38a4 UTSW 15 96999629 missense probably damaging 1.00
R0012:Slc38a4 UTSW 15 96999629 missense probably damaging 1.00
R0165:Slc38a4 UTSW 15 97008949 missense probably benign 0.00
R0304:Slc38a4 UTSW 15 97008454 missense probably damaging 1.00
R0543:Slc38a4 UTSW 15 97016839 missense possibly damaging 0.52
R0973:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R0973:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R0974:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R1340:Slc38a4 UTSW 15 97010272 splice site probably benign
R1973:Slc38a4 UTSW 15 96999597 missense probably benign 0.36
R2058:Slc38a4 UTSW 15 97008725 missense probably benign 0.22
R2083:Slc38a4 UTSW 15 97008993 missense probably benign 0.00
R2108:Slc38a4 UTSW 15 97008997 missense probably benign
R3908:Slc38a4 UTSW 15 97012994 critical splice acceptor site probably null
R4037:Slc38a4 UTSW 15 96997042 missense probably benign 0.03
R4260:Slc38a4 UTSW 15 96998493 missense probably damaging 1.00
R4261:Slc38a4 UTSW 15 96998493 missense probably damaging 1.00
R4370:Slc38a4 UTSW 15 97009084 missense possibly damaging 0.48
R4435:Slc38a4 UTSW 15 97009018 missense probably benign
R5289:Slc38a4 UTSW 15 97010348 missense possibly damaging 0.72
R5638:Slc38a4 UTSW 15 97012990 missense probably damaging 0.99
R5893:Slc38a4 UTSW 15 96999551 missense probably benign 0.23
R7059:Slc38a4 UTSW 15 97009014 nonsense probably null
R7223:Slc38a4 UTSW 15 97010345 missense probably damaging 1.00
R7267:Slc38a4 UTSW 15 97005900 missense probably benign 0.01
R7768:Slc38a4 UTSW 15 97008664 missense probably damaging 1.00
R7903:Slc38a4 UTSW 15 97008928 missense probably benign 0.03
R7986:Slc38a4 UTSW 15 97008928 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAATCCTCGGATGGTCACAG -3'
(R):5'- GATGACCTATGGCTTAAATGTTGC -3'

Sequencing Primer
(F):5'- GGTCACAGACCCTCTCTACC -3'
(R):5'- TGGCTTAAATGTTGCTTTTAATGC -3'
Posted On2015-06-20