Incidental Mutation 'R4259:Pgk2'
ID322585
Institutional Source Beutler Lab
Gene Symbol Pgk2
Ensembl Gene ENSMUSG00000031233
Gene Namephosphoglycerate kinase 2
SynonymsTcp-2, Tcp-2, Pgk-2
MMRRC Submission 041072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4259 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location40207018-40208609 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 40207383 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 385 (T385P)
Ref Sequence ENSEMBL: ENSMUSP00000033585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033585]
PDB Structure
Crystal Structure of Phosphoglycerate Kinase-2 [X-RAY DIFFRACTION]
Crystal Structure of Phosphoglycerate Kinase-2 bound to 3-phosphoglycerate [X-RAY DIFFRACTION]
Crystal structure of phosphoglycerate kinase-2 bound to atp and 3pg [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033585
AA Change: T385P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000033585
Gene: ENSMUSG00000031233
AA Change: T385P

DomainStartEndE-ValueType
Pfam:PGK 9 406 1.3e-152 PFAM
Meta Mutation Damage Score 0.5398 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is intronless, arose via retrotransposition of the phosphoglycerate kinase 1 gene, and is expressed specifically in the testis. Initially assumed to be a pseudogene, the encoded protein is actually a functional phosphoglycerate kinase that catalyzes the reversible conversion of 1,3-bisphosphoglycerate to 3-phosphoglycerate, during the Embden-Meyerhof-Parnas pathway of glycolysis, in the later stages of spermatogenesis.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased male fertility associated with reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Cd248 A G 19: 5,068,838 D238G probably damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cyp2b19 G A 7: 26,763,382 G230S probably damaging Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gpr171 A G 3: 59,097,527 S276P probably damaging Het
Hap1 C A 11: 100,351,842 probably null Het
Hcn1 A T 13: 117,975,348 K616M unknown Het
Igkv4-90 T C 6: 68,807,477 I18M possibly damaging Het
Itpr3 T A 17: 27,106,324 V1297E probably damaging Het
Kmt2b T C 7: 30,581,081 N1319D probably damaging Het
Krt72 T C 15: 101,778,257 E418G probably damaging Het
Lama1 T C 17: 67,752,418 S599P possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrk1 A T 7: 66,330,764 Y223N probably damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr150 A T 9: 39,737,703 D296V probably damaging Het
Olfr480 T A 7: 108,065,893 K272* probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pdk2 T C 11: 95,041,144 D38G probably benign Het
Prl3b1 T C 13: 27,243,906 probably null Het
Sat1 T C X: 155,215,186 probably benign Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc26a1 T A 5: 108,672,630 K250N probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Tbc1d32 A G 10: 56,049,771 S1093P probably damaging Het
Other mutations in Pgk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0195:Pgk2 UTSW 17 40207731 missense probably benign 0.01
R1297:Pgk2 UTSW 17 40208364 missense probably benign 0.04
R1351:Pgk2 UTSW 17 40207800 missense probably damaging 1.00
R1781:Pgk2 UTSW 17 40208507 missense probably benign 0.20
R2126:Pgk2 UTSW 17 40207509 missense probably damaging 1.00
R3153:Pgk2 UTSW 17 40208243 missense probably damaging 0.99
R3154:Pgk2 UTSW 17 40208243 missense probably damaging 0.99
R4152:Pgk2 UTSW 17 40208258 missense probably damaging 1.00
R4153:Pgk2 UTSW 17 40208258 missense probably damaging 1.00
R4154:Pgk2 UTSW 17 40208258 missense probably damaging 1.00
R4261:Pgk2 UTSW 17 40207383 missense probably benign 0.01
R4812:Pgk2 UTSW 17 40207390 missense possibly damaging 0.56
R4961:Pgk2 UTSW 17 40207521 missense probably damaging 1.00
R4989:Pgk2 UTSW 17 40207511 missense probably damaging 1.00
R5661:Pgk2 UTSW 17 40207396 nonsense probably null
R6246:Pgk2 UTSW 17 40207424 missense probably damaging 1.00
R6415:Pgk2 UTSW 17 40207568 missense probably benign 0.00
R7054:Pgk2 UTSW 17 40208475 missense probably benign 0.08
R7721:Pgk2 UTSW 17 40207518 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCACTGCTAGCTCATTACCTGGG -3'
(R):5'- AATTGTGGCCCAAGCAAAGC -3'

Sequencing Primer
(F):5'- ACCTGGGTCTTGATTCATAGTAGAG -3'
(R):5'- CCCAAGCAAAGCTGATAGTTTG -3'
Posted On2015-06-20