Incidental Mutation 'R4259:Sat1'
ID322590
Institutional Source Beutler Lab
Gene Symbol Sat1
Ensembl Gene ENSMUSG00000025283
Gene Namespermidine/spermine N1-acetyl transferase 1
Synonyms
MMRRC Submission 041072-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R4259 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location155213132-155216449 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 155215186 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026318] [ENSMUST00000112551] [ENSMUST00000152463]
Predicted Effect probably benign
Transcript: ENSMUST00000026318
SMART Domains Protein: ENSMUSP00000026318
Gene: ENSMUSG00000025283

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 17 144 2e-7 PFAM
Pfam:Acetyltransf_7 64 144 1.9e-9 PFAM
Pfam:Acetyltransf_1 65 146 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112551
SMART Domains Protein: ENSMUSP00000108170
Gene: ENSMUSG00000025283

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 65 153 2.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150046
Predicted Effect probably benign
Transcript: ENSMUST00000152463
SMART Domains Protein: ENSMUSP00000138776
Gene: ENSMUSG00000025283

DomainStartEndE-ValueType
SCOP:d1cjwa_ 1 64 1e-5 SMART
PDB:3BJ8|D 1 70 1e-46 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the acetyltransferase family, and is a rate-limiting enzyme in the catabolic pathway of polyamine metabolism. It catalyzes the acetylation of spermidine and spermine, and is involved in the regulation of the intracellular concentration of polyamines and their transport out of cells. Defects in this gene are associated with keratosis follicularis spinulosa decalvans (KFSD). Alternatively spliced transcripts have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, increased percent body fat and total fat pad weight, abnormal liver and white adipose tissue physiology, abnormal aerobic energy metabolism, increased serum leptin levels, and increased weight gain on a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Cd248 A G 19: 5,068,838 D238G probably damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cyp2b19 G A 7: 26,763,382 G230S probably damaging Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gpr171 A G 3: 59,097,527 S276P probably damaging Het
Hap1 C A 11: 100,351,842 probably null Het
Hcn1 A T 13: 117,975,348 K616M unknown Het
Igkv4-90 T C 6: 68,807,477 I18M possibly damaging Het
Itpr3 T A 17: 27,106,324 V1297E probably damaging Het
Kmt2b T C 7: 30,581,081 N1319D probably damaging Het
Krt72 T C 15: 101,778,257 E418G probably damaging Het
Lama1 T C 17: 67,752,418 S599P possibly damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrk1 A T 7: 66,330,764 Y223N probably damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr150 A T 9: 39,737,703 D296V probably damaging Het
Olfr480 T A 7: 108,065,893 K272* probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pdk2 T C 11: 95,041,144 D38G probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Prl3b1 T C 13: 27,243,906 probably null Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc26a1 T A 5: 108,672,630 K250N probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Tbc1d32 A G 10: 56,049,771 S1093P probably damaging Het
Other mutations in Sat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4261:Sat1 UTSW X 155215186 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- TTTCAAATGGAGGCAAAGGTTG -3'
(R):5'- TATCAAAGTTCTGTAGAAACCCGG -3'

Sequencing Primer
(F):5'- TTGCAAATTAGAGGCAATGGTTG -3'
(R):5'- TGTCCCAATCTTCAGGTT -3'
Posted On2015-06-20