Incidental Mutation 'R4260:Zap70'
ID 322591
Institutional Source Beutler Lab
Gene Symbol Zap70
Ensembl Gene ENSMUSG00000026117
Gene Name zeta-chain (TCR) associated protein kinase
Synonyms ZAP-70, TZK, Srk
MMRRC Submission 041073-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.322) question?
Stock # R4260 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 36800879-36821899 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 36818189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027291]
AlphaFold P43404
Predicted Effect probably benign
Transcript: ENSMUST00000027291
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190128
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G A 18: 80,180,742 (GRCm39) S52L possibly damaging Het
Best3 A T 10: 116,860,131 (GRCm39) M464L probably benign Het
Ccdc83 T G 7: 89,877,599 (GRCm39) D281A possibly damaging Het
Ccnf G A 17: 24,445,741 (GRCm39) P502S probably damaging Het
Cd109 T A 9: 78,543,745 (GRCm39) S96R possibly damaging Het
Cep290 A C 10: 100,350,354 (GRCm39) E649D probably damaging Het
Cntnap5a G T 1: 116,374,325 (GRCm39) A946S probably benign Het
Csnk2a2 A T 8: 96,184,027 (GRCm39) D177E probably benign Het
Cyld T C 8: 89,468,019 (GRCm39) S551P probably damaging Het
Degs1 A T 1: 182,106,806 (GRCm39) I151N probably benign Het
Dnah12 A G 14: 26,520,883 (GRCm39) I1901V probably benign Het
Eif2ak3 G A 6: 70,866,497 (GRCm39) R597H probably damaging Het
Epg5 A T 18: 78,002,336 (GRCm39) H585L possibly damaging Het
Epg5 G C 18: 78,058,914 (GRCm39) W1889C probably damaging Het
Fam220a G C 5: 143,548,762 (GRCm39) R58P possibly damaging Het
Gemin5 G A 11: 58,059,185 (GRCm39) A32V probably damaging Het
Gm11189 A C 11: 53,091,703 (GRCm39) noncoding transcript Het
Grb2 A G 11: 115,540,642 (GRCm39) I85T probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,355,630 (GRCm39) probably null Het
Ide A C 19: 37,306,585 (GRCm39) S63A unknown Het
Kel A T 6: 41,663,357 (GRCm39) probably benign Het
Kifap3 C A 1: 163,689,597 (GRCm39) T527K probably damaging Het
Klra10 A G 6: 130,249,644 (GRCm39) W214R probably damaging Het
Luc7l3 A T 11: 94,186,876 (GRCm39) probably benign Het
Mrpl4 A G 9: 20,918,988 (GRCm39) E211G possibly damaging Het
Or4k39 T A 2: 111,238,850 (GRCm39) noncoding transcript Het
Or52n5 A C 7: 104,587,803 (GRCm39) E23D probably damaging Het
Pbld2 T C 10: 62,860,186 (GRCm39) probably benign Het
Plcg1 T C 2: 160,593,627 (GRCm39) probably null Het
Ppcs A G 4: 119,279,106 (GRCm39) F149L probably damaging Het
Ptpdc1 A G 13: 48,733,234 (GRCm39) M802T probably benign Het
Ptprf A G 4: 118,083,280 (GRCm39) F909S possibly damaging Het
Raph1 A T 1: 60,542,124 (GRCm39) M330K possibly damaging Het
Rprd1a G A 18: 24,621,352 (GRCm39) R276C possibly damaging Het
Scg3 A G 9: 75,558,979 (GRCm39) Y406H probably damaging Het
Setdb1 G A 3: 95,234,808 (GRCm39) S965F probably damaging Het
Sgo2b A T 8: 64,381,330 (GRCm39) F501I probably benign Het
Slc38a4 A G 15: 96,896,374 (GRCm39) Y498H probably damaging Het
Slc5a4b A G 10: 75,939,686 (GRCm39) L150P probably damaging Het
Spata17 T A 1: 186,780,677 (GRCm39) T357S possibly damaging Het
Tmt1a A G 15: 100,210,951 (GRCm39) D141G probably benign Het
Zfp985 G A 4: 147,668,029 (GRCm39) C299Y probably damaging Het
Other mutations in Zap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36,820,230 (GRCm39) missense probably damaging 1.00
murdock APN 1 36,818,785 (GRCm39) missense probably damaging 0.99
IGL00763:Zap70 APN 1 36,818,333 (GRCm39) missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36,810,238 (GRCm39) missense probably damaging 0.99
IGL01918:Zap70 APN 1 36,817,868 (GRCm39) missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36,810,267 (GRCm39) missense probably damaging 0.99
IGL02502:Zap70 APN 1 36,817,887 (GRCm39) splice site probably benign
IGL02597:Zap70 APN 1 36,811,001 (GRCm39) nonsense probably null
IGL03026:Zap70 APN 1 36,818,798 (GRCm39) missense possibly damaging 0.94
biscayne UTSW 1 36,820,493 (GRCm39) missense probably damaging 1.00
mesa_verde UTSW 1 36,818,254 (GRCm39) missense probably damaging 1.00
shazzam UTSW 1 36,820,218 (GRCm39) missense probably damaging 1.00
trebia UTSW 1 36,820,106 (GRCm39) missense probably damaging 1.00
wanna UTSW 1 36,810,064 (GRCm39) missense probably damaging 1.00
wanna2 UTSW 1 36,820,493 (GRCm39) missense probably damaging 1.00
wanna3 UTSW 1 36,817,299 (GRCm39) missense probably damaging 0.99
wanna4 UTSW 1 36,820,446 (GRCm39) missense probably damaging 1.00
want_to UTSW 1 36,821,598 (GRCm39) missense probably damaging 1.00
waterfowl UTSW 1 36,809,892 (GRCm39) start codon destroyed probably null 0.03
zapatos UTSW 1 36,810,262 (GRCm39) missense possibly damaging 0.89
zipper UTSW 1 36,809,983 (GRCm39) missense probably benign 0.09
PIT1430001:Zap70 UTSW 1 36,818,250 (GRCm39) missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36,818,365 (GRCm39) missense probably damaging 1.00
R0701:Zap70 UTSW 1 36,820,258 (GRCm39) missense probably damaging 1.00
R0960:Zap70 UTSW 1 36,818,254 (GRCm39) missense probably damaging 1.00
R1520:Zap70 UTSW 1 36,810,036 (GRCm39) missense probably damaging 1.00
R2064:Zap70 UTSW 1 36,818,215 (GRCm39) missense probably benign
R3623:Zap70 UTSW 1 36,818,216 (GRCm39) missense probably benign 0.03
R3689:Zap70 UTSW 1 36,820,493 (GRCm39) missense probably damaging 1.00
R3690:Zap70 UTSW 1 36,820,493 (GRCm39) missense probably damaging 1.00
R3804:Zap70 UTSW 1 36,810,223 (GRCm39) missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36,817,498 (GRCm39) missense probably damaging 1.00
R4383:Zap70 UTSW 1 36,820,042 (GRCm39) missense probably damaging 1.00
R4632:Zap70 UTSW 1 36,817,539 (GRCm39) missense probably benign
R4783:Zap70 UTSW 1 36,818,254 (GRCm39) missense probably damaging 1.00
R5051:Zap70 UTSW 1 36,820,532 (GRCm39) missense probably benign 0.00
R5271:Zap70 UTSW 1 36,820,446 (GRCm39) missense probably damaging 1.00
R5304:Zap70 UTSW 1 36,817,299 (GRCm39) missense probably damaging 0.99
R5792:Zap70 UTSW 1 36,818,090 (GRCm39) intron probably benign
R5932:Zap70 UTSW 1 36,820,227 (GRCm39) missense probably damaging 1.00
R5941:Zap70 UTSW 1 36,810,030 (GRCm39) missense probably damaging 1.00
R6694:Zap70 UTSW 1 36,821,598 (GRCm39) missense probably damaging 1.00
R6825:Zap70 UTSW 1 36,817,471 (GRCm39) missense probably damaging 1.00
R7039:Zap70 UTSW 1 36,817,832 (GRCm39) missense probably benign
R7704:Zap70 UTSW 1 36,818,395 (GRCm39) critical splice donor site probably null
R7769:Zap70 UTSW 1 36,809,983 (GRCm39) missense probably benign 0.09
R8115:Zap70 UTSW 1 36,820,287 (GRCm39) missense probably damaging 1.00
R8140:Zap70 UTSW 1 36,810,262 (GRCm39) missense possibly damaging 0.89
R8289:Zap70 UTSW 1 36,820,218 (GRCm39) missense probably damaging 1.00
R9186:Zap70 UTSW 1 36,818,832 (GRCm39) missense possibly damaging 0.66
R9540:Zap70 UTSW 1 36,817,869 (GRCm39) missense possibly damaging 0.95
R9654:Zap70 UTSW 1 36,818,327 (GRCm39) missense probably benign 0.03
R9674:Zap70 UTSW 1 36,810,150 (GRCm39) missense probably benign 0.10
S24628:Zap70 UTSW 1 36,809,892 (GRCm39) start codon destroyed probably null 0.03
Z1176:Zap70 UTSW 1 36,818,257 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTAGCAAGAGTTGACAAAGCC -3'
(R):5'- AAGTTGCCACAGCCAAGCTC -3'

Sequencing Primer
(F):5'- TGCACAGCAATGCTTAGTCATC -3'
(R):5'- ACAGCCAAGCTCGATGTCCG -3'
Posted On 2015-06-20