Incidental Mutation 'R4260:Spata17'
ID322596
Institutional Source Beutler Lab
Gene Symbol Spata17
Ensembl Gene ENSMUSG00000026611
Gene Namespermatogenesis associated 17
Synonyms1700065F16Rik, 4930504I07Rik, 4930513F16Rik
MMRRC Submission 041073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4260 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location187044648-187215465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 187048480 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 357 (T357S)
Ref Sequence ENSEMBL: ENSMUSP00000138855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027908] [ENSMUST00000183819]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027908
AA Change: T357S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027908
Gene: ENSMUSG00000026611
AA Change: T357S

DomainStartEndE-ValueType
IQ 47 69 5.27e0 SMART
IQ 70 92 1.77e-2 SMART
IQ 106 128 1.4e1 SMART
coiled coil region 133 174 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183819
AA Change: T357S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138855
Gene: ENSMUSG00000026611
AA Change: T357S

DomainStartEndE-ValueType
IQ 47 69 5.27e0 SMART
IQ 70 92 1.77e-2 SMART
IQ 106 128 1.4e1 SMART
coiled coil region 133 174 N/A INTRINSIC
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G A 18: 80,137,527 S52L possibly damaging Het
Best3 A T 10: 117,024,226 M464L probably benign Het
Ccdc83 T G 7: 90,228,391 D281A possibly damaging Het
Ccnf G A 17: 24,226,767 P502S probably damaging Het
Cd109 T A 9: 78,636,463 S96R possibly damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cntnap5a G T 1: 116,446,595 A946S probably benign Het
Csnk2a2 A T 8: 95,457,399 D177E probably benign Het
Cyld T C 8: 88,741,391 S551P probably damaging Het
Degs1 A T 1: 182,279,241 I151N probably benign Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Eif2ak3 G A 6: 70,889,513 R597H probably damaging Het
Epg5 A T 18: 77,959,121 H585L possibly damaging Het
Epg5 G C 18: 78,015,699 W1889C probably damaging Het
Fam220a G C 5: 143,563,007 R58P possibly damaging Het
Gemin5 G A 11: 58,168,359 A32V probably damaging Het
Gm11189 A C 11: 53,200,876 noncoding transcript Het
Grb2 A G 11: 115,649,816 I85T probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ide A C 19: 37,329,186 S63A unknown Het
Kel A T 6: 41,686,423 probably benign Het
Kifap3 C A 1: 163,862,028 T527K probably damaging Het
Klra10 A G 6: 130,272,681 W214R probably damaging Het
Luc7l3 A T 11: 94,296,050 probably benign Het
Mettl7a1 A G 15: 100,313,070 D141G probably benign Het
Mrpl4 A G 9: 21,007,692 E211G possibly damaging Het
Olfr1285 T A 2: 111,408,505 noncoding transcript Het
Olfr669 A C 7: 104,938,596 E23D probably damaging Het
Pbld2 T C 10: 63,024,407 probably benign Het
Plcg1 T C 2: 160,751,707 probably null Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ptpdc1 A G 13: 48,579,758 M802T probably benign Het
Ptprf A G 4: 118,226,083 F909S possibly damaging Het
Raph1 A T 1: 60,502,965 M330K possibly damaging Het
Rprd1a G A 18: 24,488,295 R276C possibly damaging Het
Scg3 A G 9: 75,651,697 Y406H probably damaging Het
Setdb1 G A 3: 95,327,497 S965F probably damaging Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Zap70 T A 1: 36,779,108 probably benign Het
Zfp985 G A 4: 147,583,572 C299Y probably damaging Het
Other mutations in Spata17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Spata17 APN 1 187117339 missense probably benign 0.34
IGL02101:Spata17 APN 1 187117460 missense probably benign 0.40
IGL02268:Spata17 APN 1 187140398 missense probably damaging 0.97
IGL02406:Spata17 APN 1 187117261 critical splice donor site probably null
IGL02429:Spata17 APN 1 187140434 missense possibly damaging 0.66
IGL03333:Spata17 APN 1 187140470 start codon destroyed probably null
R0147:Spata17 UTSW 1 187112601 missense probably damaging 1.00
R0148:Spata17 UTSW 1 187112601 missense probably damaging 1.00
R0269:Spata17 UTSW 1 187097872 missense probably benign 0.02
R1521:Spata17 UTSW 1 187193994 missense probably damaging 0.96
R1620:Spata17 UTSW 1 187183215 intron probably benign
R2017:Spata17 UTSW 1 187048453 missense possibly damaging 0.73
R2113:Spata17 UTSW 1 187097911 missense possibly damaging 0.93
R2251:Spata17 UTSW 1 187048473 missense possibly damaging 0.96
R4572:Spata17 UTSW 1 187193996 missense possibly damaging 0.91
R4894:Spata17 UTSW 1 187140446 missense probably benign 0.00
R4910:Spata17 UTSW 1 187194011 missense probably damaging 0.98
R6277:Spata17 UTSW 1 187193954 nonsense probably null
R7200:Spata17 UTSW 1 187112503 missense probably benign 0.00
R7735:Spata17 UTSW 1 187140380 missense unknown
V7732:Spata17 UTSW 1 187048480 missense possibly damaging 0.53
X0027:Spata17 UTSW 1 187193959 missense probably damaging 0.97
Z1177:Spata17 UTSW 1 187117328 missense possibly damaging 0.86
Z1177:Spata17 UTSW 1 187140429 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTCACATGAATATTGTCACAGC -3'
(R):5'- AGACCTGTGTGCTTGCTAGG -3'

Sequencing Primer
(F):5'- GTCACAGCATTTTAAAAGTACCTAAC -3'
(R):5'- ATAATGATGTCCAGGCCTGC -3'
Posted On2015-06-20