Incidental Mutation 'R4260:Zfp985'
ID322602
Institutional Source Beutler Lab
Gene Symbol Zfp985
Ensembl Gene ENSMUSG00000065999
Gene Namezinc finger protein 985
SynonymsGm13154
MMRRC Submission 041073-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R4260 (G1)
Quality Score218
Status Validated
Chromosome4
Chromosomal Location147553277-147585198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 147583572 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 299 (C299Y)
Ref Sequence ENSEMBL: ENSMUSP00000080438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081742] [ENSMUST00000139784] [ENSMUST00000143885]
Predicted Effect probably damaging
Transcript: ENSMUST00000081742
AA Change: C299Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080438
Gene: ENSMUSG00000065999
AA Change: C299Y

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
ZnF_C2H2 238 260 8.34e-3 SMART
ZnF_C2H2 266 288 1.47e-3 SMART
ZnF_C2H2 294 316 2.36e-2 SMART
ZnF_C2H2 322 344 8.34e-3 SMART
ZnF_C2H2 350 372 7.67e-2 SMART
ZnF_C2H2 378 400 8.6e-5 SMART
ZnF_C2H2 406 428 8.6e-5 SMART
ZnF_C2H2 434 456 7.9e-4 SMART
ZnF_C2H2 462 484 1.95e-3 SMART
ZnF_C2H2 490 512 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139784
SMART Domains Protein: ENSMUSP00000123296
Gene: ENSMUSG00000065999

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143885
SMART Domains Protein: ENSMUSP00000121177
Gene: ENSMUSG00000065999

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
Meta Mutation Damage Score 0.7111 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G A 18: 80,137,527 S52L possibly damaging Het
Best3 A T 10: 117,024,226 M464L probably benign Het
Ccdc83 T G 7: 90,228,391 D281A possibly damaging Het
Ccnf G A 17: 24,226,767 P502S probably damaging Het
Cd109 T A 9: 78,636,463 S96R possibly damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cntnap5a G T 1: 116,446,595 A946S probably benign Het
Csnk2a2 A T 8: 95,457,399 D177E probably benign Het
Cyld T C 8: 88,741,391 S551P probably damaging Het
Degs1 A T 1: 182,279,241 I151N probably benign Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Eif2ak3 G A 6: 70,889,513 R597H probably damaging Het
Epg5 A T 18: 77,959,121 H585L possibly damaging Het
Epg5 G C 18: 78,015,699 W1889C probably damaging Het
Fam220a G C 5: 143,563,007 R58P possibly damaging Het
Gemin5 G A 11: 58,168,359 A32V probably damaging Het
Gm11189 A C 11: 53,200,876 noncoding transcript Het
Grb2 A G 11: 115,649,816 I85T probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ide A C 19: 37,329,186 S63A unknown Het
Kel A T 6: 41,686,423 probably benign Het
Kifap3 C A 1: 163,862,028 T527K probably damaging Het
Klra10 A G 6: 130,272,681 W214R probably damaging Het
Luc7l3 A T 11: 94,296,050 probably benign Het
Mettl7a1 A G 15: 100,313,070 D141G probably benign Het
Mrpl4 A G 9: 21,007,692 E211G possibly damaging Het
Olfr1285 T A 2: 111,408,505 noncoding transcript Het
Olfr669 A C 7: 104,938,596 E23D probably damaging Het
Pbld2 T C 10: 63,024,407 probably benign Het
Plcg1 T C 2: 160,751,707 probably null Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ptpdc1 A G 13: 48,579,758 M802T probably benign Het
Ptprf A G 4: 118,226,083 F909S possibly damaging Het
Raph1 A T 1: 60,502,965 M330K possibly damaging Het
Rprd1a G A 18: 24,488,295 R276C possibly damaging Het
Scg3 A G 9: 75,651,697 Y406H probably damaging Het
Setdb1 G A 3: 95,327,497 S965F probably damaging Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Spata17 T A 1: 187,048,480 T357S possibly damaging Het
Zap70 T A 1: 36,779,108 probably benign Het
Other mutations in Zfp985
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0098:Zfp985 UTSW 4 147577109 missense probably damaging 0.97
R0324:Zfp985 UTSW 4 147582857 missense probably benign 0.00
R1307:Zfp985 UTSW 4 147583247 missense probably benign
R1594:Zfp985 UTSW 4 147583080 missense probably benign 0.05
R1657:Zfp985 UTSW 4 147584110 missense probably benign 0.01
R1667:Zfp985 UTSW 4 147583950 missense possibly damaging 0.84
R1761:Zfp985 UTSW 4 147584045 missense probably benign 0.00
R1858:Zfp985 UTSW 4 147582858 missense probably benign 0.29
R2509:Zfp985 UTSW 4 147582986 missense possibly damaging 0.75
R2510:Zfp985 UTSW 4 147582986 missense possibly damaging 0.75
R2847:Zfp985 UTSW 4 147583011 nonsense probably null
R2848:Zfp985 UTSW 4 147583011 nonsense probably null
R4245:Zfp985 UTSW 4 147582939 missense probably damaging 0.96
R4434:Zfp985 UTSW 4 147583911 missense probably benign 0.37
R4480:Zfp985 UTSW 4 147584079 missense probably benign 0.07
R4512:Zfp985 UTSW 4 147583563 missense probably damaging 1.00
R4514:Zfp985 UTSW 4 147583563 missense probably damaging 1.00
R4528:Zfp985 UTSW 4 147582890 missense possibly damaging 0.49
R4836:Zfp985 UTSW 4 147584155 missense probably damaging 0.97
R4884:Zfp985 UTSW 4 147583344 missense probably benign 0.04
R5054:Zfp985 UTSW 4 147582981 missense probably damaging 0.98
R5106:Zfp985 UTSW 4 147584155 missense probably damaging 0.97
R5205:Zfp985 UTSW 4 147582911 missense probably damaging 1.00
R5266:Zfp985 UTSW 4 147582832 critical splice acceptor site probably null
R5468:Zfp985 UTSW 4 147583245 missense probably benign
R5533:Zfp985 UTSW 4 147582983 nonsense probably null
R6282:Zfp985 UTSW 4 147583348 missense probably benign 0.00
R6303:Zfp985 UTSW 4 147583775 missense probably benign 0.01
R6609:Zfp985 UTSW 4 147583121 missense probably benign
R6609:Zfp985 UTSW 4 147583667 missense probably damaging 1.00
R6722:Zfp985 UTSW 4 147583071 missense probably benign 0.26
R6858:Zfp985 UTSW 4 147583307 nonsense probably null
R7064:Zfp985 UTSW 4 147583116 missense probably benign 0.20
R7216:Zfp985 UTSW 4 147583456 missense probably damaging 1.00
R7471:Zfp985 UTSW 4 147582931 missense possibly damaging 0.75
R7583:Zfp985 UTSW 4 147583489 nonsense probably null
R7685:Zfp985 UTSW 4 147582874 missense probably benign 0.00
X0050:Zfp985 UTSW 4 147583271 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGAAATGCAGAATTTGAGAAGGTT -3'
(R):5'- AGCATTTGTCACATTCACTGCAT -3'

Sequencing Primer
(F):5'- CAGATCCATCTTAGAAGTCATCAGGG -3'
(R):5'- GTCACATTCACTGCATTTGTAAGG -3'
Posted On2015-06-20