Mutagenetix > Incidental Mutations

Incidental Mutation 'R4260:Zfp985'

322602

Institutional Source

Beutler Lab

Gene Symbol

Zfp985

Ensembl Gene

ENSMUSG00000065999

Gene Name

zinc finger protein 985

Synonyms

Gm13154

MMRRC Submission

041073-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.385) question?

Stock #

R4260 (G1)

Quality Score

218

Status

Validated

Chromosome

Chromosomal Location

147553277-147585198 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 147583572 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 299 (C299Y)

Ref Sequence

ENSEMBL: ENSMUSP00000080438 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081742] [ENSMUST00000139784] [ENSMUST00000143885]

Predicted Effect

probably damaging
Transcript: ENSMUST00000081742
AA Change: C299Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080438
Gene: ENSMUSG00000065999
AA Change: C299Y

Domain	Start	End	E-Value	Type
KRAB	13	72	4.36e-15	SMART
ZnF_C2H2	238	260	8.34e-3	SMART
ZnF_C2H2	266	288	1.47e-3	SMART
ZnF_C2H2	294	316	2.36e-2	SMART
ZnF_C2H2	322	344	8.34e-3	SMART
ZnF_C2H2	350	372	7.67e-2	SMART
ZnF_C2H2	378	400	8.6e-5	SMART
ZnF_C2H2	406	428	8.6e-5	SMART
ZnF_C2H2	434	456	7.9e-4	SMART
ZnF_C2H2	462	484	1.95e-3	SMART
ZnF_C2H2	490	512	2.09e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139784

SMART Domains

Protein: ENSMUSP00000123296
Gene: ENSMUSG00000065999

Domain	Start	End	E-Value	Type
KRAB	13	72	4.36e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143885

SMART Domains

Protein: ENSMUSP00000121177
Gene: ENSMUSG00000065999

Domain	Start	End	E-Value	Type
KRAB	13	72	4.36e-15	SMART

Meta Mutation Damage Score

0.7111

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

98% (50/51)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adnp2	G	A	18: 80,137,527	S52L	possibly damaging	Het
Best3	A	T	10: 117,024,226	M464L	probably benign	Het
Ccdc83	T	G	7: 90,228,391	D281A	possibly damaging	Het
Ccnf	G	A	17: 24,226,767	P502S	probably damaging	Het
Cd109	T	A	9: 78,636,463	S96R	possibly damaging	Het
Cep290	A	C	10: 100,514,492	E649D	probably damaging	Het
Cntnap5a	G	T	1: 116,446,595	A946S	probably benign	Het
Csnk2a2	A	T	8: 95,457,399	D177E	probably benign	Het
Cyld	T	C	8: 88,741,391	S551P	probably damaging	Het
Degs1	A	T	1: 182,279,241	I151N	probably benign	Het
Dnah12	A	G	14: 26,798,926	I1901V	probably benign	Het
Eif2ak3	G	A	6: 70,889,513	R597H	probably damaging	Het
Epg5	G	C	18: 78,015,699	W1889C	probably damaging	Het
Epg5	A	T	18: 77,959,121	H585L	possibly damaging	Het
Fam220a	G	C	5: 143,563,007	R58P	possibly damaging	Het
Gemin5	G	A	11: 58,168,359	A32V	probably damaging	Het
Gm11189	A	C	11: 53,200,876		noncoding transcript	Het
Grb2	A	G	11: 115,649,816	I85T	probably damaging	Het
Herc1	CTGAGGACTCTTTG	CTG	9: 66,448,348		probably null	Het
Ide	A	C	19: 37,329,186	S63A	unknown	Het
Kel	A	T	6: 41,686,423		probably benign	Het
Kifap3	C	A	1: 163,862,028	T527K	probably damaging	Het
Klra10	A	G	6: 130,272,681	W214R	probably damaging	Het
Luc7l3	A	T	11: 94,296,050		probably benign	Het
Mettl7a1	A	G	15: 100,313,070	D141G	probably benign	Het
Mrpl4	A	G	9: 21,007,692	E211G	possibly damaging	Het
Olfr1285	T	A	2: 111,408,505		noncoding transcript	Het
Olfr669	A	C	7: 104,938,596	E23D	probably damaging	Het
Pbld2	T	C	10: 63,024,407		probably benign	Het
Plcg1	T	C	2: 160,751,707		probably null	Het
Ppcs	A	G	4: 119,421,909	F149L	probably damaging	Het
Ptpdc1	A	G	13: 48,579,758	M802T	probably benign	Het
Ptprf	A	G	4: 118,226,083	F909S	possibly damaging	Het
Raph1	A	T	1: 60,502,965	M330K	possibly damaging	Het
Rprd1a	G	A	18: 24,488,295	R276C	possibly damaging	Het
Scg3	A	G	9: 75,651,697	Y406H	probably damaging	Het
Setdb1	G	A	3: 95,327,497	S965F	probably damaging	Het
Sgo2b	A	T	8: 63,928,296	F501I	probably benign	Het
Slc38a4	A	G	15: 96,998,493	Y498H	probably damaging	Het
Slc5a4b	A	G	10: 76,103,852	L150P	probably damaging	Het
Spata17	T	A	1: 187,048,480	T357S	possibly damaging	Het
Zap70	T	A	1: 36,779,108		probably benign	Het

Other mutations in Zfp985

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0098:Zfp985	UTSW	4	147577109	missense	probably damaging	0.97
R0324:Zfp985	UTSW	4	147582857	missense	probably benign	0.00
R1307:Zfp985	UTSW	4	147583247	missense	probably benign
R1594:Zfp985	UTSW	4	147583080	missense	probably benign	0.05
R1657:Zfp985	UTSW	4	147584110	missense	probably benign	0.01
R1667:Zfp985	UTSW	4	147583950	missense	possibly damaging	0.84
R1761:Zfp985	UTSW	4	147584045	missense	probably benign	0.00
R1858:Zfp985	UTSW	4	147582858	missense	probably benign	0.29
R2509:Zfp985	UTSW	4	147582986	missense	possibly damaging	0.75
R2510:Zfp985	UTSW	4	147582986	missense	possibly damaging	0.75
R2847:Zfp985	UTSW	4	147583011	nonsense	probably null
R2848:Zfp985	UTSW	4	147583011	nonsense	probably null
R4245:Zfp985	UTSW	4	147582939	missense	probably damaging	0.96
R4434:Zfp985	UTSW	4	147583911	missense	probably benign	0.37
R4480:Zfp985	UTSW	4	147584079	missense	probably benign	0.07
R4512:Zfp985	UTSW	4	147583563	missense	probably damaging	1.00
R4514:Zfp985	UTSW	4	147583563	missense	probably damaging	1.00
R4528:Zfp985	UTSW	4	147582890	missense	possibly damaging	0.49
R4836:Zfp985	UTSW	4	147584155	missense	probably damaging	0.97
R4884:Zfp985	UTSW	4	147583344	missense	probably benign	0.04
R5054:Zfp985	UTSW	4	147582981	missense	probably damaging	0.98
R5106:Zfp985	UTSW	4	147584155	missense	probably damaging	0.97
R5205:Zfp985	UTSW	4	147582911	missense	probably damaging	1.00
R5266:Zfp985	UTSW	4	147582832	critical splice acceptor site	probably null
R5468:Zfp985	UTSW	4	147583245	missense	probably benign
R5533:Zfp985	UTSW	4	147582983	nonsense	probably null
R6282:Zfp985	UTSW	4	147583348	missense	probably benign	0.00
R6303:Zfp985	UTSW	4	147583775	missense	probably benign	0.01
R6609:Zfp985	UTSW	4	147583121	missense	probably benign
R6609:Zfp985	UTSW	4	147583667	missense	probably damaging	1.00
R6722:Zfp985	UTSW	4	147583071	missense	probably benign	0.26
R6858:Zfp985	UTSW	4	147583307	nonsense	probably null
R7064:Zfp985	UTSW	4	147583116	missense	probably benign	0.20
R7216:Zfp985	UTSW	4	147583456	missense	probably damaging	1.00
R7471:Zfp985	UTSW	4	147582931	missense	possibly damaging	0.75
R7583:Zfp985	UTSW	4	147583489	nonsense	probably null
R7685:Zfp985	UTSW	4	147582874	missense	probably benign	0.00
R8242:Zfp985	UTSW	4	147584182	missense	possibly damaging	0.52
R8504:Zfp985	UTSW	4	147583426	missense	possibly damaging	0.70
X0050:Zfp985	UTSW	4	147583271	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CGAAATGCAGAATTTGAGAAGGTT -3'
(R):5'- AGCATTTGTCACATTCACTGCAT -3'

Sequencing Primer
(F):5'- CAGATCCATCTTAGAAGTCATCAGGG -3'
(R):5'- GTCACATTCACTGCATTTGTAAGG -3'

Posted On

2015-06-20