Incidental Mutation 'R4260:Fam220a'
ID322603
Institutional Source Beutler Lab
Gene Symbol Fam220a
Ensembl Gene ENSMUSG00000083012
Gene Namefamily with sequence similarity 220, member A
Synonyms
MMRRC Submission 041073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4260 (G1)
Quality Score118
Status Validated
Chromosome5
Chromosomal Location143548706-143564531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 143563007 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 58 (R58P)
Ref Sequence ENSEMBL: ENSMUSP00000142548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067145] [ENSMUST00000101434] [ENSMUST00000119488] [ENSMUST00000169329] [ENSMUST00000196487] [ENSMUST00000200267]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067145
AA Change: R58P

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063424
Gene: ENSMUSG00000083012
AA Change: R58P

DomainStartEndE-ValueType
Pfam:FAM220 2 259 1.8e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101434
SMART Domains Protein: ENSMUSP00000117552
Gene: ENSMUSG00000083012

DomainStartEndE-ValueType
Pfam:DUF4560 2 65 8.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119488
SMART Domains Protein: ENSMUSP00000114024
Gene: ENSMUSG00000083012

DomainStartEndE-ValueType
Pfam:DUF4560 2 65 1.6e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169329
AA Change: R58P

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126480
Gene: ENSMUSG00000083012
AA Change: R58P

DomainStartEndE-ValueType
Pfam:FAM220 2 259 1.8e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196487
AA Change: R58P

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143202
Gene: ENSMUSG00000083012
AA Change: R58P

DomainStartEndE-ValueType
Pfam:FAM220 2 259 1.8e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200267
AA Change: R58P

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142548
Gene: ENSMUSG00000083012
AA Change: R58P

DomainStartEndE-ValueType
Pfam:FAM220 2 259 1.8e-82 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G A 18: 80,137,527 S52L possibly damaging Het
Best3 A T 10: 117,024,226 M464L probably benign Het
Ccdc83 T G 7: 90,228,391 D281A possibly damaging Het
Ccnf G A 17: 24,226,767 P502S probably damaging Het
Cd109 T A 9: 78,636,463 S96R possibly damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cntnap5a G T 1: 116,446,595 A946S probably benign Het
Csnk2a2 A T 8: 95,457,399 D177E probably benign Het
Cyld T C 8: 88,741,391 S551P probably damaging Het
Degs1 A T 1: 182,279,241 I151N probably benign Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Eif2ak3 G A 6: 70,889,513 R597H probably damaging Het
Epg5 A T 18: 77,959,121 H585L possibly damaging Het
Epg5 G C 18: 78,015,699 W1889C probably damaging Het
Gemin5 G A 11: 58,168,359 A32V probably damaging Het
Gm11189 A C 11: 53,200,876 noncoding transcript Het
Grb2 A G 11: 115,649,816 I85T probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ide A C 19: 37,329,186 S63A unknown Het
Kel A T 6: 41,686,423 probably benign Het
Kifap3 C A 1: 163,862,028 T527K probably damaging Het
Klra10 A G 6: 130,272,681 W214R probably damaging Het
Luc7l3 A T 11: 94,296,050 probably benign Het
Mettl7a1 A G 15: 100,313,070 D141G probably benign Het
Mrpl4 A G 9: 21,007,692 E211G possibly damaging Het
Olfr1285 T A 2: 111,408,505 noncoding transcript Het
Olfr669 A C 7: 104,938,596 E23D probably damaging Het
Pbld2 T C 10: 63,024,407 probably benign Het
Plcg1 T C 2: 160,751,707 probably null Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ptpdc1 A G 13: 48,579,758 M802T probably benign Het
Ptprf A G 4: 118,226,083 F909S possibly damaging Het
Raph1 A T 1: 60,502,965 M330K possibly damaging Het
Rprd1a G A 18: 24,488,295 R276C possibly damaging Het
Scg3 A G 9: 75,651,697 Y406H probably damaging Het
Setdb1 G A 3: 95,327,497 S965F probably damaging Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Spata17 T A 1: 187,048,480 T357S possibly damaging Het
Zap70 T A 1: 36,779,108 probably benign Het
Zfp985 G A 4: 147,583,572 C299Y probably damaging Het
Other mutations in Fam220a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02266:Fam220a APN 5 143563571 missense possibly damaging 0.51
R1978:Fam220a UTSW 5 143563127 missense probably damaging 1.00
R5711:Fam220a UTSW 5 143563457 missense probably damaging 0.98
R6086:Fam220a UTSW 5 143563041 missense probably benign 0.12
R7466:Fam220a UTSW 5 143563471 missense possibly damaging 0.93
R7823:Fam220a UTSW 5 143563256 missense probably damaging 0.99
X0013:Fam220a UTSW 5 143563513 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TTGACTGATAGGCCTCACCC -3'
(R):5'- GCTAGTTGCTCTTCTGAAGGAGC -3'

Sequencing Primer
(F):5'- CCTGCATCAAAGGGCACAGAG -3'
(R):5'- CTCTTCTGAAGGAGCAGGGGAC -3'
Posted On2015-06-20