Incidental Mutation 'R4260:Ccdc83'
ID322608
Institutional Source Beutler Lab
Gene Symbol Ccdc83
Ensembl Gene ENSMUSG00000030617
Gene Namecoiled-coil domain containing 83
Synonyms4930549K11Rik, 4930554C01Rik, 4932423M01Rik
MMRRC Submission 041073-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4260 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location90223873-90265777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 90228391 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 281 (D281A)
Ref Sequence ENSEMBL: ENSMUSP00000102839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107221]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107221
AA Change: D281A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102839
Gene: ENSMUSG00000030617
AA Change: D281A

DomainStartEndE-ValueType
coiled coil region 37 75 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
coiled coil region 107 182 N/A INTRINSIC
Blast:BROMO 202 232 1e-5 BLAST
low complexity region 241 249 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G A 18: 80,137,527 S52L possibly damaging Het
Best3 A T 10: 117,024,226 M464L probably benign Het
Ccnf G A 17: 24,226,767 P502S probably damaging Het
Cd109 T A 9: 78,636,463 S96R possibly damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cntnap5a G T 1: 116,446,595 A946S probably benign Het
Csnk2a2 A T 8: 95,457,399 D177E probably benign Het
Cyld T C 8: 88,741,391 S551P probably damaging Het
Degs1 A T 1: 182,279,241 I151N probably benign Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Eif2ak3 G A 6: 70,889,513 R597H probably damaging Het
Epg5 A T 18: 77,959,121 H585L possibly damaging Het
Epg5 G C 18: 78,015,699 W1889C probably damaging Het
Fam220a G C 5: 143,563,007 R58P possibly damaging Het
Gemin5 G A 11: 58,168,359 A32V probably damaging Het
Gm11189 A C 11: 53,200,876 noncoding transcript Het
Grb2 A G 11: 115,649,816 I85T probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ide A C 19: 37,329,186 S63A unknown Het
Kel A T 6: 41,686,423 probably benign Het
Kifap3 C A 1: 163,862,028 T527K probably damaging Het
Klra10 A G 6: 130,272,681 W214R probably damaging Het
Luc7l3 A T 11: 94,296,050 probably benign Het
Mettl7a1 A G 15: 100,313,070 D141G probably benign Het
Mrpl4 A G 9: 21,007,692 E211G possibly damaging Het
Olfr1285 T A 2: 111,408,505 noncoding transcript Het
Olfr669 A C 7: 104,938,596 E23D probably damaging Het
Pbld2 T C 10: 63,024,407 probably benign Het
Plcg1 T C 2: 160,751,707 probably null Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ptpdc1 A G 13: 48,579,758 M802T probably benign Het
Ptprf A G 4: 118,226,083 F909S possibly damaging Het
Raph1 A T 1: 60,502,965 M330K possibly damaging Het
Rprd1a G A 18: 24,488,295 R276C possibly damaging Het
Scg3 A G 9: 75,651,697 Y406H probably damaging Het
Setdb1 G A 3: 95,327,497 S965F probably damaging Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Spata17 T A 1: 187,048,480 T357S possibly damaging Het
Zap70 T A 1: 36,779,108 probably benign Het
Zfp985 G A 4: 147,583,572 C299Y probably damaging Het
Other mutations in Ccdc83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Ccdc83 APN 7 90244044 missense probably damaging 1.00
IGL01092:Ccdc83 APN 7 90247105 missense probably benign 0.11
IGL01394:Ccdc83 APN 7 90224001 missense probably damaging 1.00
IGL02585:Ccdc83 APN 7 90236912 missense probably damaging 1.00
IGL02631:Ccdc83 APN 7 90244069 missense possibly damaging 0.76
PIT4354001:Ccdc83 UTSW 7 90223974 missense probably benign 0.21
R0189:Ccdc83 UTSW 7 90226683 missense possibly damaging 0.94
R0538:Ccdc83 UTSW 7 90228383 missense probably damaging 0.99
R1441:Ccdc83 UTSW 7 90244143 missense probably damaging 1.00
R1478:Ccdc83 UTSW 7 90259469 missense probably damaging 0.99
R1781:Ccdc83 UTSW 7 90250541 missense probably damaging 1.00
R1929:Ccdc83 UTSW 7 90224077 missense probably damaging 1.00
R1969:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R1970:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R1971:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R2008:Ccdc83 UTSW 7 90244141 missense probably damaging 1.00
R2220:Ccdc83 UTSW 7 90259514 missense probably damaging 0.96
R2271:Ccdc83 UTSW 7 90224077 missense probably damaging 1.00
R2426:Ccdc83 UTSW 7 90228431 missense probably damaging 1.00
R2985:Ccdc83 UTSW 7 90236367 intron probably benign
R3712:Ccdc83 UTSW 7 90236355 intron probably benign
R4241:Ccdc83 UTSW 7 90247138 missense probably damaging 1.00
R4374:Ccdc83 UTSW 7 90226778 nonsense probably null
R5071:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5072:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5074:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5749:Ccdc83 UTSW 7 90223948 missense probably damaging 1.00
R5929:Ccdc83 UTSW 7 90236316 intron probably benign
R6283:Ccdc83 UTSW 7 90236407 nonsense probably null
R6574:Ccdc83 UTSW 7 90226677 missense possibly damaging 0.69
R6725:Ccdc83 UTSW 7 90247053 missense probably damaging 1.00
R7320:Ccdc83 UTSW 7 90224034 missense probably damaging 1.00
R7485:Ccdc83 UTSW 7 90223930 missense probably benign 0.17
R7511:Ccdc83 UTSW 7 90236922 missense possibly damaging 0.69
R7750:Ccdc83 UTSW 7 90223982 nonsense probably null
R7773:Ccdc83 UTSW 7 90229912 missense probably damaging 1.00
R7950:Ccdc83 UTSW 7 90229787 splice site probably null
X0067:Ccdc83 UTSW 7 90247155 missense possibly damaging 0.94
Z1088:Ccdc83 UTSW 7 90244046 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGGCAATACCCCATTCCTC -3'
(R):5'- TCGCTAAGAACTGTCACTTTGG -3'

Sequencing Primer
(F):5'- TTAAAACTCAGGTCCAGCAGTG -3'
(R):5'- CGCTAAGAACTGTCACTTTGGAATTC -3'
Posted On2015-06-20