Incidental Mutation 'R4260:Cyld'
ID322611
Institutional Source Beutler Lab
Gene Symbol Cyld
Ensembl Gene ENSMUSG00000036712
Gene NameCYLD lysine 63 deubiquitinase
SynonymsCYLD1, C130039D01Rik, 2900009M21Rik, 2010013M14Rik
MMRRC Submission 041073-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4260 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location88697028-88751945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88741391 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 551 (S551P)
Ref Sequence ENSEMBL: ENSMUSP00000147904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043526] [ENSMUST00000098519] [ENSMUST00000109626] [ENSMUST00000209206] [ENSMUST00000209532] [ENSMUST00000209559] [ENSMUST00000211554]
Predicted Effect probably damaging
Transcript: ENSMUST00000043526
AA Change: S736P

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039834
Gene: ENSMUSG00000036712
AA Change: S736P

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
low complexity region 397 411 N/A INTRINSIC
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 591 891 1.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098519
AA Change: S736P

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096119
Gene: ENSMUSG00000036712
AA Change: S736P

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 307 470 6.5e-88 PFAM
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 590 893 2.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109626
AA Change: S733P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105254
Gene: ENSMUSG00000036712
AA Change: S733P

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 304 467 2.5e-88 PFAM
CAP_GLY 468 536 2.68e-20 SMART
Pfam:UCH 587 890 2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209206
AA Change: S551P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209532
AA Change: S736P

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000209559
AA Change: S733P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210302
Predicted Effect probably damaging
Transcript: ENSMUST00000211554
AA Change: S733P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211671
Meta Mutation Damage Score 0.9335 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the ubiquitin C-terminal hydrolase subfamily of the deubiquitinating enzyme family. Members of this family catalyze the removal of ubiquitin from a substrate or another ubiquitin molecule and thereby play important roles in regulating signaling pathways, recycling ubiquitin and regulating protein stability. This protein removes ubiquitin from K-63-linked ubiquitin chains from proteins involved in NF-kappaB signaling and thus acts as a negative regulator of this pathway. In humans mutations in this gene have been associated with cylindromatosis, an autosomal dominant predisposition to tumors of skin appendages. In mouse deficiency of this gene impairs thymocyte development and increases susceptibility to skin and colon tumors. A pseudogene of this gene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Various knockout models with different exon deletions have been created. Observed phenotypes include altered T cell and B cell development, susceptibility to induced skin tumors, resistance to lethal lung infection, high colon tumor incidence, kinky tails, and neonatal death due to lung dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G A 18: 80,137,527 S52L possibly damaging Het
Best3 A T 10: 117,024,226 M464L probably benign Het
Ccdc83 T G 7: 90,228,391 D281A possibly damaging Het
Ccnf G A 17: 24,226,767 P502S probably damaging Het
Cd109 T A 9: 78,636,463 S96R possibly damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cntnap5a G T 1: 116,446,595 A946S probably benign Het
Csnk2a2 A T 8: 95,457,399 D177E probably benign Het
Degs1 A T 1: 182,279,241 I151N probably benign Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Eif2ak3 G A 6: 70,889,513 R597H probably damaging Het
Epg5 A T 18: 77,959,121 H585L possibly damaging Het
Epg5 G C 18: 78,015,699 W1889C probably damaging Het
Fam220a G C 5: 143,563,007 R58P possibly damaging Het
Gemin5 G A 11: 58,168,359 A32V probably damaging Het
Gm11189 A C 11: 53,200,876 noncoding transcript Het
Grb2 A G 11: 115,649,816 I85T probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ide A C 19: 37,329,186 S63A unknown Het
Kel A T 6: 41,686,423 probably benign Het
Kifap3 C A 1: 163,862,028 T527K probably damaging Het
Klra10 A G 6: 130,272,681 W214R probably damaging Het
Luc7l3 A T 11: 94,296,050 probably benign Het
Mettl7a1 A G 15: 100,313,070 D141G probably benign Het
Mrpl4 A G 9: 21,007,692 E211G possibly damaging Het
Olfr1285 T A 2: 111,408,505 noncoding transcript Het
Olfr669 A C 7: 104,938,596 E23D probably damaging Het
Pbld2 T C 10: 63,024,407 probably benign Het
Plcg1 T C 2: 160,751,707 probably null Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ptpdc1 A G 13: 48,579,758 M802T probably benign Het
Ptprf A G 4: 118,226,083 F909S possibly damaging Het
Raph1 A T 1: 60,502,965 M330K possibly damaging Het
Rprd1a G A 18: 24,488,295 R276C possibly damaging Het
Scg3 A G 9: 75,651,697 Y406H probably damaging Het
Setdb1 G A 3: 95,327,497 S965F probably damaging Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Spata17 T A 1: 187,048,480 T357S possibly damaging Het
Zap70 T A 1: 36,779,108 probably benign Het
Zfp985 G A 4: 147,583,572 C299Y probably damaging Het
Other mutations in Cyld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Cyld APN 8 88705457 missense probably benign 0.41
IGL00481:Cyld APN 8 88707290 missense probably damaging 1.00
IGL01013:Cyld APN 8 88742362 missense probably damaging 1.00
IGL01653:Cyld APN 8 88741370 missense probably damaging 1.00
IGL01700:Cyld APN 8 88707099 missense probably damaging 0.99
IGL01845:Cyld APN 8 88705775 nonsense probably null
IGL02366:Cyld APN 8 88729753 missense probably damaging 1.00
IGL02379:Cyld APN 8 88744928 nonsense probably null
IGL02506:Cyld APN 8 88729590 missense possibly damaging 0.86
IGL02563:Cyld APN 8 88735894 missense probably damaging 1.00
IGL02565:Cyld APN 8 88741291 missense probably damaging 1.00
IGL02814:Cyld APN 8 88744897 missense probably benign 0.29
PIT4131001:Cyld UTSW 8 88746915 missense probably damaging 0.98
R0101:Cyld UTSW 8 88718300 critical splice donor site probably null
R0122:Cyld UTSW 8 88742292 missense probably damaging 1.00
R0529:Cyld UTSW 8 88729759 missense probably benign 0.34
R0838:Cyld UTSW 8 88741350 missense probably benign 0.15
R1589:Cyld UTSW 8 88709990 missense possibly damaging 0.84
R1732:Cyld UTSW 8 88731667 splice site probably benign
R2029:Cyld UTSW 8 88745312 missense probably benign 0.09
R3701:Cyld UTSW 8 88729551 missense probably benign
R3798:Cyld UTSW 8 88734930 missense probably damaging 1.00
R4243:Cyld UTSW 8 88730755 nonsense probably null
R4244:Cyld UTSW 8 88730755 nonsense probably null
R4458:Cyld UTSW 8 88719301 missense probably benign 0.24
R4551:Cyld UTSW 8 88707134 missense possibly damaging 0.95
R4718:Cyld UTSW 8 88742305 missense probably damaging 0.99
R4735:Cyld UTSW 8 88729650 missense probably damaging 1.00
R4753:Cyld UTSW 8 88744816 splice site probably null
R4966:Cyld UTSW 8 88742301 missense possibly damaging 0.55
R4975:Cyld UTSW 8 88707232 missense probably benign
R5375:Cyld UTSW 8 88733036 missense possibly damaging 0.77
R5647:Cyld UTSW 8 88734926 missense probably benign 0.10
R5741:Cyld UTSW 8 88744846 missense probably damaging 1.00
R5837:Cyld UTSW 8 88741404 missense probably damaging 0.99
R5931:Cyld UTSW 8 88729842 splice site probably null
R5970:Cyld UTSW 8 88732993 missense probably damaging 0.99
R5992:Cyld UTSW 8 88733053 missense probably damaging 1.00
R6165:Cyld UTSW 8 88746933 missense possibly damaging 0.88
R7135:Cyld UTSW 8 88744892 missense possibly damaging 0.93
R7667:Cyld UTSW 8 88742302 missense probably benign 0.01
R7858:Cyld UTSW 8 88709988 missense probably damaging 0.98
R7912:Cyld UTSW 8 88734897 missense probably damaging 1.00
R7941:Cyld UTSW 8 88709988 missense probably damaging 0.98
R7993:Cyld UTSW 8 88734897 missense probably damaging 1.00
RF016:Cyld UTSW 8 88705441 nonsense probably null
X0010:Cyld UTSW 8 88746912 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCATTGTCTTTTACCTGGCATTGG -3'
(R):5'- TCTTAACAGGGTGAGTGAGAGC -3'

Sequencing Primer
(F):5'- CAGAGCTGCACATCTGTATCATGG -3'
(R):5'- AGAGCTGGGTGTGGTTGAGC -3'
Posted On2015-06-20