Incidental Mutation 'R4260:Slc5a4b'
ID322618
Institutional Source Beutler Lab
Gene Symbol Slc5a4b
Ensembl Gene ENSMUSG00000020226
Gene Namesolute carrier family 5 (neutral amino acid transporters, system A), member 4b
SynonymspSGLT2, SGLT3b, 2010104G07Rik, SAAT1
MMRRC Submission 041073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R4260 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76057494-76110961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76103852 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 150 (L150P)
Ref Sequence ENSEMBL: ENSMUSP00000113582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120757]
Predicted Effect probably damaging
Transcript: ENSMUST00000120757
AA Change: L150P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113582
Gene: ENSMUSG00000020226
AA Change: L150P

DomainStartEndE-ValueType
low complexity region 16 21 N/A INTRINSIC
Pfam:SSF 58 492 1.4e-163 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 640 659 N/A INTRINSIC
Meta Mutation Damage Score 0.9413 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G A 18: 80,137,527 S52L possibly damaging Het
Best3 A T 10: 117,024,226 M464L probably benign Het
Ccdc83 T G 7: 90,228,391 D281A possibly damaging Het
Ccnf G A 17: 24,226,767 P502S probably damaging Het
Cd109 T A 9: 78,636,463 S96R possibly damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cntnap5a G T 1: 116,446,595 A946S probably benign Het
Csnk2a2 A T 8: 95,457,399 D177E probably benign Het
Cyld T C 8: 88,741,391 S551P probably damaging Het
Degs1 A T 1: 182,279,241 I151N probably benign Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Eif2ak3 G A 6: 70,889,513 R597H probably damaging Het
Epg5 A T 18: 77,959,121 H585L possibly damaging Het
Epg5 G C 18: 78,015,699 W1889C probably damaging Het
Fam220a G C 5: 143,563,007 R58P possibly damaging Het
Gemin5 G A 11: 58,168,359 A32V probably damaging Het
Gm11189 A C 11: 53,200,876 noncoding transcript Het
Grb2 A G 11: 115,649,816 I85T probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ide A C 19: 37,329,186 S63A unknown Het
Kel A T 6: 41,686,423 probably benign Het
Kifap3 C A 1: 163,862,028 T527K probably damaging Het
Klra10 A G 6: 130,272,681 W214R probably damaging Het
Luc7l3 A T 11: 94,296,050 probably benign Het
Mettl7a1 A G 15: 100,313,070 D141G probably benign Het
Mrpl4 A G 9: 21,007,692 E211G possibly damaging Het
Olfr1285 T A 2: 111,408,505 noncoding transcript Het
Olfr669 A C 7: 104,938,596 E23D probably damaging Het
Pbld2 T C 10: 63,024,407 probably benign Het
Plcg1 T C 2: 160,751,707 probably null Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ptpdc1 A G 13: 48,579,758 M802T probably benign Het
Ptprf A G 4: 118,226,083 F909S possibly damaging Het
Raph1 A T 1: 60,502,965 M330K possibly damaging Het
Rprd1a G A 18: 24,488,295 R276C possibly damaging Het
Scg3 A G 9: 75,651,697 Y406H probably damaging Het
Setdb1 G A 3: 95,327,497 S965F probably damaging Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Spata17 T A 1: 187,048,480 T357S possibly damaging Het
Zap70 T A 1: 36,779,108 probably benign Het
Zfp985 G A 4: 147,583,572 C299Y probably damaging Het
Other mutations in Slc5a4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Slc5a4b APN 10 76070588 missense probably damaging 1.00
IGL01433:Slc5a4b APN 10 76070495 splice site probably benign
IGL01754:Slc5a4b APN 10 76070615 missense probably damaging 1.00
IGL01904:Slc5a4b APN 10 76060426 missense probably damaging 0.98
IGL01990:Slc5a4b APN 10 76060354 missense probably benign 0.01
IGL02211:Slc5a4b APN 10 76060463 splice site probably benign
IGL02254:Slc5a4b APN 10 76060430 missense probably benign
IGL02389:Slc5a4b APN 10 76072465 nonsense probably null
IGL02427:Slc5a4b APN 10 76058879 missense possibly damaging 0.47
IGL02493:Slc5a4b APN 10 76075015 missense probably damaging 1.00
IGL02554:Slc5a4b APN 10 76110851 missense possibly damaging 0.75
IGL02670:Slc5a4b APN 10 76075100 missense probably damaging 1.00
R0254:Slc5a4b UTSW 10 76070628 missense possibly damaging 0.55
R0285:Slc5a4b UTSW 10 76062283 missense probably damaging 0.99
R0294:Slc5a4b UTSW 10 76081327 missense probably damaging 1.00
R0522:Slc5a4b UTSW 10 76090700 missense probably damaging 0.99
R0601:Slc5a4b UTSW 10 76064036 missense possibly damaging 0.81
R0714:Slc5a4b UTSW 10 76081507 missense probably benign 0.09
R0975:Slc5a4b UTSW 10 76081407 missense probably benign 0.09
R1934:Slc5a4b UTSW 10 76081473 missense possibly damaging 0.51
R2339:Slc5a4b UTSW 10 76108549 missense probably damaging 1.00
R2886:Slc5a4b UTSW 10 76075073 missense probably damaging 0.98
R3552:Slc5a4b UTSW 10 76081524 missense probably damaging 0.99
R3890:Slc5a4b UTSW 10 76062260 missense probably benign 0.01
R4012:Slc5a4b UTSW 10 76074992 missense probably damaging 1.00
R4259:Slc5a4b UTSW 10 76103852 missense probably damaging 1.00
R4471:Slc5a4b UTSW 10 76058891 nonsense probably null
R4667:Slc5a4b UTSW 10 76075045 missense possibly damaging 0.78
R4846:Slc5a4b UTSW 10 76062239 missense probably damaging 0.99
R4939:Slc5a4b UTSW 10 76081467 missense probably benign 0.44
R5181:Slc5a4b UTSW 10 76060387 nonsense probably null
R5319:Slc5a4b UTSW 10 76062399 missense probably benign 0.08
R6306:Slc5a4b UTSW 10 76081351 missense probably benign 0.01
R6422:Slc5a4b UTSW 10 76103862 missense probably damaging 0.97
R6837:Slc5a4b UTSW 10 76062386 missense possibly damaging 0.49
R6997:Slc5a4b UTSW 10 76089978 missense probably damaging 0.97
R7140:Slc5a4b UTSW 10 76075109 missense probably damaging 1.00
R7527:Slc5a4b UTSW 10 76110908 missense probably benign 0.01
R7683:Slc5a4b UTSW 10 76064072 missense probably damaging 0.96
R7718:Slc5a4b UTSW 10 76070573 missense probably damaging 1.00
R7794:Slc5a4b UTSW 10 76062299 missense probably benign 0.19
R7877:Slc5a4b UTSW 10 76075052 missense probably damaging 1.00
R8150:Slc5a4b UTSW 10 76103846 missense possibly damaging 0.93
X0019:Slc5a4b UTSW 10 76110851 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GCTAGTAGGGTTAGATGGCTTATAC -3'
(R):5'- GTCCACAGACTATGCAAGGG -3'

Sequencing Primer
(F):5'- GCTGCTGAAACACCACAT -3'
(R):5'- CCACAGACTATGCAAGGGTTTTG -3'
Posted On2015-06-20