Incidental Mutation 'R4260:Luc7l3'
ID322624
Institutional Source Beutler Lab
Gene Symbol Luc7l3
Ensembl Gene ENSMUSG00000020863
Gene NameLUC7-like 3 (S. cerevisiae)
Synonyms3300001P08Rik
MMRRC Submission 041073-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4260 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94287890-94321988 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 94296050 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000021226] [ENSMUST00000107820] [ENSMUST00000107821] [ENSMUST00000107822] [ENSMUST00000166312]
Predicted Effect unknown
Transcript: ENSMUST00000021226
AA Change: H336Q
SMART Domains Protein: ENSMUSP00000021226
Gene: ENSMUSG00000020863
AA Change: H336Q

DomainStartEndE-ValueType
Pfam:LUC7 3 293 2.3e-89 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000107820
AA Change: H336Q
SMART Domains Protein: ENSMUSP00000103450
Gene: ENSMUSG00000020863
AA Change: H336Q

DomainStartEndE-ValueType
Pfam:LUC7 1 302 4.2e-72 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000107821
AA Change: H336Q
SMART Domains Protein: ENSMUSP00000103451
Gene: ENSMUSG00000020863
AA Change: H336Q

DomainStartEndE-ValueType
Pfam:LUC7 1 302 4.2e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107822
Predicted Effect unknown
Transcript: ENSMUST00000132623
AA Change: H71Q
SMART Domains Protein: ENSMUSP00000131166
Gene: ENSMUSG00000020863
AA Change: H71Q

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135311
Predicted Effect probably benign
Transcript: ENSMUST00000138369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165620
Predicted Effect unknown
Transcript: ENSMUST00000166312
AA Change: H336Q
SMART Domains Protein: ENSMUSP00000129919
Gene: ENSMUSG00000020863
AA Change: H336Q

DomainStartEndE-ValueType
Pfam:LUC7 1 300 7.9e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171033
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal half that contains cysteine/histidine motifs and leucine zipper-like repeats, and the C-terminal half is rich in arginine and glutamate residues (RE domain) and arginine and serine residues (RS domain). This protein localizes with a speckled pattern in the nucleus, and could be involved in the formation of splicesome via the RE and RS domains. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G A 18: 80,137,527 S52L possibly damaging Het
Best3 A T 10: 117,024,226 M464L probably benign Het
Ccdc83 T G 7: 90,228,391 D281A possibly damaging Het
Ccnf G A 17: 24,226,767 P502S probably damaging Het
Cd109 T A 9: 78,636,463 S96R possibly damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cntnap5a G T 1: 116,446,595 A946S probably benign Het
Csnk2a2 A T 8: 95,457,399 D177E probably benign Het
Cyld T C 8: 88,741,391 S551P probably damaging Het
Degs1 A T 1: 182,279,241 I151N probably benign Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Eif2ak3 G A 6: 70,889,513 R597H probably damaging Het
Epg5 A T 18: 77,959,121 H585L possibly damaging Het
Epg5 G C 18: 78,015,699 W1889C probably damaging Het
Fam220a G C 5: 143,563,007 R58P possibly damaging Het
Gemin5 G A 11: 58,168,359 A32V probably damaging Het
Gm11189 A C 11: 53,200,876 noncoding transcript Het
Grb2 A G 11: 115,649,816 I85T probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ide A C 19: 37,329,186 S63A unknown Het
Kel A T 6: 41,686,423 probably benign Het
Kifap3 C A 1: 163,862,028 T527K probably damaging Het
Klra10 A G 6: 130,272,681 W214R probably damaging Het
Mettl7a1 A G 15: 100,313,070 D141G probably benign Het
Mrpl4 A G 9: 21,007,692 E211G possibly damaging Het
Olfr1285 T A 2: 111,408,505 noncoding transcript Het
Olfr669 A C 7: 104,938,596 E23D probably damaging Het
Pbld2 T C 10: 63,024,407 probably benign Het
Plcg1 T C 2: 160,751,707 probably null Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ptpdc1 A G 13: 48,579,758 M802T probably benign Het
Ptprf A G 4: 118,226,083 F909S possibly damaging Het
Raph1 A T 1: 60,502,965 M330K possibly damaging Het
Rprd1a G A 18: 24,488,295 R276C possibly damaging Het
Scg3 A G 9: 75,651,697 Y406H probably damaging Het
Setdb1 G A 3: 95,327,497 S965F probably damaging Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Spata17 T A 1: 187,048,480 T357S possibly damaging Het
Zap70 T A 1: 36,779,108 probably benign Het
Zfp985 G A 4: 147,583,572 C299Y probably damaging Het
Other mutations in Luc7l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Luc7l3 APN 11 94303942 missense probably benign 0.43
IGL02138:Luc7l3 APN 11 94303966 missense probably benign 0.00
IGL02318:Luc7l3 APN 11 94292993 missense probably benign 0.05
IGL02479:Luc7l3 APN 11 94296909 unclassified probably benign
IGL02563:Luc7l3 APN 11 94300068 splice site probably null
veritas UTSW 11 94292953 missense probably damaging 0.98
R0096:Luc7l3 UTSW 11 94301494 splice site probably benign
R0096:Luc7l3 UTSW 11 94301494 splice site probably benign
R1706:Luc7l3 UTSW 11 94297756 splice site probably benign
R3803:Luc7l3 UTSW 11 94293166 utr 3 prime probably benign
R4647:Luc7l3 UTSW 11 94309641 missense probably damaging 1.00
R5153:Luc7l3 UTSW 11 94295980 unclassified probably benign
R5179:Luc7l3 UTSW 11 94300053 missense possibly damaging 0.92
R5591:Luc7l3 UTSW 11 94293234 unclassified probably benign
R6767:Luc7l3 UTSW 11 94292953 missense probably damaging 0.98
R6912:Luc7l3 UTSW 11 94309636 missense probably damaging 0.97
R7168:Luc7l3 UTSW 11 94299984 missense unknown
R7541:Luc7l3 UTSW 11 94295965 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCTGGAGCACAGCAAGTAG -3'
(R):5'- AGCTTCAATCTTAAGGGAAGCCC -3'

Sequencing Primer
(F):5'- CAAGTAGGGGTACGGGTTGC -3'
(R):5'- TTGGAACTCACTCTGTAGACCAGG -3'
Posted On2015-06-20