Incidental Mutation 'R4260:Slc38a4'
ID322628
Institutional Source Beutler Lab
Gene Symbol Slc38a4
Ensembl Gene ENSMUSG00000022464
Gene Namesolute carrier family 38, member 4
Synonyms1700012A18Rik, Ata3, 1110012E16Rik
MMRRC Submission 041073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R4260 (G1)
Quality Score141
Status Validated
Chromosome15
Chromosomal Location96994820-97055956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96998493 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 498 (Y498H)
Ref Sequence ENSEMBL: ENSMUSP00000155158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023101] [ENSMUST00000166223] [ENSMUST00000230086] [ENSMUST00000231039]
Predicted Effect probably damaging
Transcript: ENSMUST00000023101
AA Change: Y498H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023101
Gene: ENSMUSG00000022464
AA Change: Y498H

DomainStartEndE-ValueType
Pfam:Aa_trans 73 263 4.9e-38 PFAM
Pfam:Aa_trans 302 535 2.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166223
AA Change: Y498H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127676
Gene: ENSMUSG00000022464
AA Change: Y498H

DomainStartEndE-ValueType
Pfam:Aa_trans 73 262 2.5e-38 PFAM
Pfam:Aa_trans 303 535 2.5e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000230086
AA Change: Y498H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231039
AA Change: Y498H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8773 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC38A4 is found predominantly in liver and transports both cationic and neutral amino acids. The transport of cationic amino acids by SLC38A4 is Na(+) and pH independent, while the transport of neutral amino acids is Na(+) and pH dependent (Hatanaka et al., 2001 [PubMed 11342143]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G A 18: 80,137,527 S52L possibly damaging Het
Best3 A T 10: 117,024,226 M464L probably benign Het
Ccdc83 T G 7: 90,228,391 D281A possibly damaging Het
Ccnf G A 17: 24,226,767 P502S probably damaging Het
Cd109 T A 9: 78,636,463 S96R possibly damaging Het
Cep290 A C 10: 100,514,492 E649D probably damaging Het
Cntnap5a G T 1: 116,446,595 A946S probably benign Het
Csnk2a2 A T 8: 95,457,399 D177E probably benign Het
Cyld T C 8: 88,741,391 S551P probably damaging Het
Degs1 A T 1: 182,279,241 I151N probably benign Het
Dnah12 A G 14: 26,798,926 I1901V probably benign Het
Eif2ak3 G A 6: 70,889,513 R597H probably damaging Het
Epg5 A T 18: 77,959,121 H585L possibly damaging Het
Epg5 G C 18: 78,015,699 W1889C probably damaging Het
Fam220a G C 5: 143,563,007 R58P possibly damaging Het
Gemin5 G A 11: 58,168,359 A32V probably damaging Het
Gm11189 A C 11: 53,200,876 noncoding transcript Het
Grb2 A G 11: 115,649,816 I85T probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ide A C 19: 37,329,186 S63A unknown Het
Kel A T 6: 41,686,423 probably benign Het
Kifap3 C A 1: 163,862,028 T527K probably damaging Het
Klra10 A G 6: 130,272,681 W214R probably damaging Het
Luc7l3 A T 11: 94,296,050 probably benign Het
Mettl7a1 A G 15: 100,313,070 D141G probably benign Het
Mrpl4 A G 9: 21,007,692 E211G possibly damaging Het
Olfr1285 T A 2: 111,408,505 noncoding transcript Het
Olfr669 A C 7: 104,938,596 E23D probably damaging Het
Pbld2 T C 10: 63,024,407 probably benign Het
Plcg1 T C 2: 160,751,707 probably null Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ptpdc1 A G 13: 48,579,758 M802T probably benign Het
Ptprf A G 4: 118,226,083 F909S possibly damaging Het
Raph1 A T 1: 60,502,965 M330K possibly damaging Het
Rprd1a G A 18: 24,488,295 R276C possibly damaging Het
Scg3 A G 9: 75,651,697 Y406H probably damaging Het
Setdb1 G A 3: 95,327,497 S965F probably damaging Het
Sgo2b A T 8: 63,928,296 F501I probably benign Het
Slc5a4b A G 10: 76,103,852 L150P probably damaging Het
Spata17 T A 1: 187,048,480 T357S possibly damaging Het
Zap70 T A 1: 36,779,108 probably benign Het
Zfp985 G A 4: 147,583,572 C299Y probably damaging Het
Other mutations in Slc38a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Slc38a4 APN 15 97019809 missense probably benign 0.01
IGL00229:Slc38a4 APN 15 96999494 missense probably damaging 0.99
IGL00974:Slc38a4 APN 15 96999516 missense probably benign 0.05
IGL01951:Slc38a4 APN 15 97019763 missense probably benign 0.07
R0012:Slc38a4 UTSW 15 96999629 missense probably damaging 1.00
R0012:Slc38a4 UTSW 15 96999629 missense probably damaging 1.00
R0165:Slc38a4 UTSW 15 97008949 missense probably benign 0.00
R0304:Slc38a4 UTSW 15 97008454 missense probably damaging 1.00
R0543:Slc38a4 UTSW 15 97016839 missense possibly damaging 0.52
R0973:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R0973:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R0974:Slc38a4 UTSW 15 97005858 missense probably benign 0.04
R1340:Slc38a4 UTSW 15 97010272 splice site probably benign
R1973:Slc38a4 UTSW 15 96999597 missense probably benign 0.36
R2058:Slc38a4 UTSW 15 97008725 missense probably benign 0.22
R2083:Slc38a4 UTSW 15 97008993 missense probably benign 0.00
R2108:Slc38a4 UTSW 15 97008997 missense probably benign
R3908:Slc38a4 UTSW 15 97012994 critical splice acceptor site probably null
R4037:Slc38a4 UTSW 15 96997042 missense probably benign 0.03
R4259:Slc38a4 UTSW 15 96998493 missense probably damaging 1.00
R4261:Slc38a4 UTSW 15 96998493 missense probably damaging 1.00
R4370:Slc38a4 UTSW 15 97009084 missense possibly damaging 0.48
R4435:Slc38a4 UTSW 15 97009018 missense probably benign
R5289:Slc38a4 UTSW 15 97010348 missense possibly damaging 0.72
R5638:Slc38a4 UTSW 15 97012990 missense probably damaging 0.99
R5893:Slc38a4 UTSW 15 96999551 missense probably benign 0.23
R7059:Slc38a4 UTSW 15 97009014 nonsense probably null
R7223:Slc38a4 UTSW 15 97010345 missense probably damaging 1.00
R7267:Slc38a4 UTSW 15 97005900 missense probably benign 0.01
R7768:Slc38a4 UTSW 15 97008664 missense probably damaging 1.00
R7903:Slc38a4 UTSW 15 97008928 missense probably benign 0.03
R7986:Slc38a4 UTSW 15 97008928 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATCCTCGGATGGTCACAGAC -3'
(R):5'- CAAGATGACCTATGGCTTAAATGTTGC -3'

Sequencing Primer
(F):5'- GGTCACAGACCCTCTCTACC -3'
(R):5'- TGGCTTAAATGTTGCTTTTAATGC -3'
Posted On2015-06-20