Mutagenetix > Incidental Mutations

Incidental Mutation 'R4261:Adamts4'

322636

Institutional Source

Beutler Lab

Gene Symbol

Adamts4

Ensembl Gene

ENSMUSG00000006403

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4

Synonyms

aggrecanase-1, ADAM-TS4

MMRRC Submission

041074-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4261 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

171250421-171260637 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 171259104 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 822 (P822S)

Ref Sequence

ENSEMBL: ENSMUSP00000151387 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111314] [ENSMUST00000111315] [ENSMUST00000219033]

Predicted Effect

probably benign
Transcript: ENSMUST00000111314
AA Change: P625S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000106946
Gene: ENSMUSG00000006403
AA Change: P625S

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
Pfam:Reprolysin_5	27	214	1.8e-12	PFAM
Pfam:Reprolysin	29	239	1e-19	PFAM
Pfam:Reprolysin_4	33	235	1.2e-10	PFAM
Pfam:Reprolysin_3	50	183	5.4e-12	PFAM
Pfam:Reprolysin_2	50	229	1.9e-9	PFAM
Blast:ACR	240	319	4e-24	BLAST
TSP1	334	386	3.52e-14	SMART
Pfam:ADAM_spacer1	497	614	5.2e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111315
AA Change: P810S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000106947
Gene: ENSMUSG00000006403
AA Change: P810S

Domain	Start	End	E-Value	Type
signal peptide	1	49	N/A	INTRINSIC
Pfam:Pep_M12B_propep	54	177	5.6e-17	PFAM
Pfam:Reprolysin_5	212	399	6.5e-12	PFAM
Pfam:Reprolysin	214	424	4.6e-19	PFAM
Pfam:Reprolysin_4	219	420	4.6e-10	PFAM
Pfam:Reprolysin_3	235	368	1.9e-11	PFAM
Pfam:Reprolysin_2	236	414	7.2e-9	PFAM
Blast:ACR	425	504	4e-24	BLAST
TSP1	519	571	3.52e-14	SMART
Pfam:ADAM_spacer1	682	799	1.8e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000219033
AA Change: P822S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

Meta Mutation Damage Score

0.0599

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active zinc-dependent aggrecanase enzyme that degrades cartilage. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutant mice do not exhibit any morphological abnormalities. However, they do display impaired coordination and an increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	C	17: 8,995,234	S298P	probably damaging	Het
4930407I10Rik	A	G	15: 82,063,726	D608G	possibly damaging	Het
Actr10	T	C	12: 70,952,985	V185A	probably benign	Het
Adam9	G	A	8: 24,964,907	Q733*	probably null	Het
Arhgap9	G	C	10: 127,328,465	R537P	probably damaging	Het
Bsn	T	A	9: 108,110,684		probably benign	Het
Car5a	A	T	8: 121,944,749	H15Q	probably benign	Het
Disp1	A	T	1: 183,089,386	I490N	probably damaging	Het
Dlgap5	T	G	14: 47,413,788	Y96S	probably damaging	Het
Dnah10	T	A	5: 124,730,137	V162D	possibly damaging	Het
Dock7	A	T	4: 99,003,886	M821K	possibly damaging	Het
Exoc3l	T	C	8: 105,290,967	R528G	probably damaging	Het
Fam234b	G	A	6: 135,209,136	G17E	unknown	Het
Grhl2	G	A	15: 37,360,823	G617D	possibly damaging	Het
Herc1	CTGAGGACTCTTTG	CTG	9: 66,448,348		probably null	Het
Hoxd9	C	A	2: 74,695,687		probably benign	Het
Hspa9	A	G	18: 34,939,423	S550P	probably damaging	Het
Ide	A	C	19: 37,329,186	S63A	unknown	Het
Kat6b	T	A	14: 21,669,669	I1363N	probably damaging	Het
Ltbp1	T	A	17: 75,291,367	C614*	probably null	Het
Mphosph8	A	G	14: 56,674,465	D315G	probably benign	Het
Mthfr-ps1	A	C	5: 78,474,483		noncoding transcript	Het
Mug1	A	G	6: 121,873,734	T730A	probably benign	Het
Myef2	T	C	2: 125,115,479	T119A	possibly damaging	Het
Pald1	A	G	10: 61,343,692	L466P	probably damaging	Het
Pcdh15	G	A	10: 74,645,680	V286M	probably damaging	Het
Pcdhgb2	A	G	18: 37,691,897	D647G	probably damaging	Het
Pdgfrb	A	C	18: 61,077,631	T737P	probably benign	Het
Pgk2	T	G	17: 40,207,383	T385P	probably benign	Het
Pkp4	A	G	2: 59,305,162	Y126C	probably damaging	Het
Plppr1	A	G	4: 49,300,993	I109V	probably benign	Het
Ppcs	A	G	4: 119,421,909	F149L	probably damaging	Het
Ppp2r5d	G	A	17: 46,687,081	Q219*	probably null	Het
Raf1	C	T	6: 115,623,054		probably null	Het
Rfx7	C	T	9: 72,616,643	R372W	probably damaging	Het
Robo4	C	A	9: 37,405,581	S397R	probably benign	Het
Sat1	T	C	X: 155,215,186		probably benign	Het
Serpina1c	T	C	12: 103,897,080	K287R	probably benign	Het
Sgsm2	T	A	11: 74,892,028	H34L	probably damaging	Het
Slc38a4	A	G	15: 96,998,493	Y498H	probably damaging	Het
Ttn	T	A	2: 76,798,040	Y14592F	probably damaging	Het
Ube3b	T	C	5: 114,398,428	F245S	possibly damaging	Het
Ugt3a2	G	A	15: 9,335,793		probably null	Het
Wdr91	T	A	6: 34,904,522	S297C	possibly damaging	Het
Zcwpw2	T	C	9: 117,998,914		noncoding transcript	Het

Other mutations in Adamts4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01472:Adamts4	APN	1	171252850	missense	probably damaging	1.00
IGL02496:Adamts4	APN	1	171250943	missense	probably benign	0.00
IGL02510:Adamts4	APN	1	171251390	missense	probably benign	0.08
IGL02695:Adamts4	APN	1	171252634	missense	probably damaging	1.00
IGL02952:Adamts4	APN	1	171251348	missense	probably damaging	1.00
IGL03010:Adamts4	APN	1	171251416	missense	probably damaging	1.00
IGL03304:Adamts4	APN	1	171252869	splice site	probably benign
PIT4305001:Adamts4	UTSW	1	171259041	missense	probably benign
R0331:Adamts4	UTSW	1	171250972	missense	probably benign	0.00
R1302:Adamts4	UTSW	1	171253183	missense	probably damaging	1.00
R1460:Adamts4	UTSW	1	171256440	splice site	probably benign
R1502:Adamts4	UTSW	1	171258990	missense	probably damaging	1.00
R1544:Adamts4	UTSW	1	171252742	missense	probably benign	0.09
R1815:Adamts4	UTSW	1	171256336	missense	probably damaging	0.99
R1982:Adamts4	UTSW	1	171258934	missense	probably benign	0.00
R1986:Adamts4	UTSW	1	171256675	missense	possibly damaging	0.94
R2281:Adamts4	UTSW	1	171256229	missense	probably damaging	1.00
R4750:Adamts4	UTSW	1	171251066	missense	probably benign
R4868:Adamts4	UTSW	1	171252431	intron	probably benign
R4924:Adamts4	UTSW	1	171259074	missense	probably damaging	0.97
R5418:Adamts4	UTSW	1	171252574	missense	probably damaging	1.00
R5468:Adamts4	UTSW	1	171252609	missense	probably benign
R5566:Adamts4	UTSW	1	171250850	start codon destroyed	probably null	0.90
R5781:Adamts4	UTSW	1	171251015	missense	possibly damaging	0.89
R6043:Adamts4	UTSW	1	171252601	missense	probably damaging	1.00
R6053:Adamts4	UTSW	1	171252715	missense	possibly damaging	0.85
R6187:Adamts4	UTSW	1	171250993	missense	probably damaging	1.00
R6614:Adamts4	UTSW	1	171256624	missense	probably benign	0.07
R6976:Adamts4	UTSW	1	171252308	intron	probably benign
R7291:Adamts4	UTSW	1	171256528	missense	probably benign
R7363:Adamts4	UTSW	1	171259039	missense	probably benign	0.40
R7490:Adamts4	UTSW	1	171256600	nonsense	probably null
R7797:Adamts4	UTSW	1	171257818	missense	probably damaging	1.00
R8191:Adamts4	UTSW	1	171252723	missense
R8408:Adamts4	UTSW	1	171252745	missense	possibly damaging	0.56
X0062:Adamts4	UTSW	1	171256549	missense	probably damaging	1.00
Z1176:Adamts4	UTSW	1	171258783	missense	probably benign	0.00
Z1176:Adamts4	UTSW	1	171258784	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- CCTCAATGGTGAATACACGCTG -3'
(R):5'- CCCTACTGTGTTTTAGCAGGAG -3'

Sequencing Primer
(F):5'- TGGTGAATACACGCTGATGCC -3'
(R):5'- GGCAGTTGCAGAAGCCTG -3'

Posted On

2015-06-20