Mutagenetix > Incidental Mutation

Incidental Mutation 'R4261:Pkp4'

322639

Institutional Source

Beutler Lab

Gene Symbol

Pkp4

Ensembl Gene

ENSMUSG00000026991

Gene Name

plakophilin 4

Synonyms

Armrp, 9430019K17Rik, 5031422I09Rik, p0071

MMRRC Submission

041074-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4261 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59160850-59355208 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59305162 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 126 (Y126C)

Ref Sequence

ENSEMBL: ENSMUSP00000139141 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037903] [ENSMUST00000102754] [ENSMUST00000112577] [ENSMUST00000123908] [ENSMUST00000168631] [ENSMUST00000183359] [ENSMUST00000184332] [ENSMUST00000184705]

AlphaFold

Q68FH0

Predicted Effect

probably damaging
Transcript: ENSMUST00000037903
AA Change: Y126C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000042249
Gene: ENSMUSG00000026991
AA Change: Y126C

Domain	Start	End	E-Value	Type
coiled coil region	41	63	N/A	INTRINSIC
low complexity region	230	246	N/A	INTRINSIC
low complexity region	324	337	N/A	INTRINSIC
low complexity region	467	478	N/A	INTRINSIC
ARM	574	614	5.68e-9	SMART
ARM	618	659	1.61e-8	SMART
ARM	660	717	4.54e1	SMART
ARM	719	766	9.97e0	SMART
low complexity region	777	788	N/A	INTRINSIC
ARM	876	916	3.34e-6	SMART
ARM	964	1008	1.32e-4	SMART
low complexity region	1057	1073	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102754
AA Change: Y126C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099815
Gene: ENSMUSG00000026991
AA Change: Y126C

Domain	Start	End	E-Value	Type
coiled coil region	41	63	N/A	INTRINSIC
low complexity region	230	246	N/A	INTRINSIC
low complexity region	324	337	N/A	INTRINSIC
low complexity region	467	478	N/A	INTRINSIC
ARM	558	598	5.68e-9	SMART
ARM	602	643	1.61e-8	SMART
ARM	644	701	4.54e1	SMART
ARM	703	750	9.97e0	SMART
low complexity region	761	772	N/A	INTRINSIC
ARM	860	900	3.34e-6	SMART
ARM	948	992	1.32e-4	SMART
low complexity region	1083	1100	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112577

SMART Domains

Protein: ENSMUSP00000108196
Gene: ENSMUSG00000026991

Domain	Start	End	E-Value	Type
low complexity region	126	137	N/A	INTRINSIC
ARM	217	257	5.68e-9	SMART
ARM	261	302	1.61e-8	SMART
ARM	303	360	4.54e1	SMART
ARM	362	409	9.97e0	SMART
low complexity region	420	431	N/A	INTRINSIC
ARM	519	559	3.34e-6	SMART
ARM	607	651	1.32e-4	SMART
low complexity region	742	759	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000123908
AA Change: Y126C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122152
Gene: ENSMUSG00000026991
AA Change: Y126C

Domain	Start	End	E-Value	Type
coiled coil region	41	63	N/A	INTRINSIC
low complexity region	230	246	N/A	INTRINSIC
low complexity region	324	337	N/A	INTRINSIC
low complexity region	467	478	N/A	INTRINSIC
ARM	574	614	5.68e-9	SMART
ARM	618	659	1.61e-8	SMART
ARM	660	717	4.54e1	SMART
ARM	719	766	9.97e0	SMART
low complexity region	777	788	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124725

Predicted Effect

probably damaging
Transcript: ENSMUST00000168631
AA Change: Y126C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129836
Gene: ENSMUSG00000026991
AA Change: Y126C

Domain	Start	End	E-Value	Type
coiled coil region	41	63	N/A	INTRINSIC
low complexity region	230	246	N/A	INTRINSIC
low complexity region	324	337	N/A	INTRINSIC
low complexity region	467	478	N/A	INTRINSIC
ARM	558	598	5.68e-9	SMART
ARM	602	643	1.61e-8	SMART
ARM	644	701	4.54e1	SMART
ARM	703	750	9.97e0	SMART
low complexity region	761	772	N/A	INTRINSIC
ARM	860	900	3.34e-6	SMART
ARM	948	992	1.32e-4	SMART
low complexity region	1041	1057	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000183359
AA Change: Y126C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139141
Gene: ENSMUSG00000026991
AA Change: Y126C

Domain	Start	End	E-Value	Type
coiled coil region	41	63	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183625

Predicted Effect

probably benign
Transcript: ENSMUST00000184332

Predicted Effect

probably benign
Transcript: ENSMUST00000184705

Meta Mutation Damage Score

0.0894

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo-like proteins are characterized by a series of armadillo repeats, first defined in the Drosophila 'armadillo' gene product, that are typically 42 to 45 amino acids in length. These proteins can be divided into subfamilies based on their number of repeats, their overall sequence similarity, and the dispersion of the repeats throughout their sequences. Members of the p120(ctn)/plakophilin subfamily of Armadillo-like proteins, including CTNND1, CTNND2, PKP1, PKP2, PKP4, and ARVCF. PKP4 may be a component of desmosomal plaque and other adhesion plaques and is thought to be involved in regulating junctional plaque organization and cadherin function. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype during the observation period early in life, although abnormalities may still develop at older age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	C	17: 8,995,234	S298P	probably damaging	Het
4930407I10Rik	A	G	15: 82,063,726	D608G	possibly damaging	Het
Actr10	T	C	12: 70,952,985	V185A	probably benign	Het
Adam9	G	A	8: 24,964,907	Q733*	probably null	Het
Adamts4	C	T	1: 171,259,104	P822S	probably benign	Het
Arhgap9	G	C	10: 127,328,465	R537P	probably damaging	Het
Bsn	T	A	9: 108,110,684		probably benign	Het
Car5a	A	T	8: 121,944,749	H15Q	probably benign	Het
Disp1	A	T	1: 183,089,386	I490N	probably damaging	Het
Dlgap5	T	G	14: 47,413,788	Y96S	probably damaging	Het
Dnah10	T	A	5: 124,730,137	V162D	possibly damaging	Het
Dock7	A	T	4: 99,003,886	M821K	possibly damaging	Het
Exoc3l	T	C	8: 105,290,967	R528G	probably damaging	Het
Fam234b	G	A	6: 135,209,136	G17E	unknown	Het
Grhl2	G	A	15: 37,360,823	G617D	possibly damaging	Het
Herc1	CTGAGGACTCTTTG	CTG	9: 66,448,348		probably null	Het
Hoxd9	C	A	2: 74,695,687		probably benign	Het
Hspa9	A	G	18: 34,939,423	S550P	probably damaging	Het
Ide	A	C	19: 37,329,186	S63A	unknown	Het
Kat6b	T	A	14: 21,669,669	I1363N	probably damaging	Het
Ltbp1	T	A	17: 75,291,367	C614*	probably null	Het
Mphosph8	A	G	14: 56,674,465	D315G	probably benign	Het
Mthfr-ps1	A	C	5: 78,474,483		noncoding transcript	Het
Mug1	A	G	6: 121,873,734	T730A	probably benign	Het
Myef2	T	C	2: 125,115,479	T119A	possibly damaging	Het
Pald1	A	G	10: 61,343,692	L466P	probably damaging	Het
Pcdh15	G	A	10: 74,645,680	V286M	probably damaging	Het
Pcdhgb2	A	G	18: 37,691,897	D647G	probably damaging	Het
Pdgfrb	A	C	18: 61,077,631	T737P	probably benign	Het
Pgk2	T	G	17: 40,207,383	T385P	probably benign	Het
Plppr1	A	G	4: 49,300,993	I109V	probably benign	Het
Ppcs	A	G	4: 119,421,909	F149L	probably damaging	Het
Ppp2r5d	G	A	17: 46,687,081	Q219*	probably null	Het
Raf1	C	T	6: 115,623,054		probably null	Het
Rfx7	C	T	9: 72,616,643	R372W	probably damaging	Het
Robo4	C	A	9: 37,405,581	S397R	probably benign	Het
Sat1	T	C	X: 155,215,186		probably benign	Het
Serpina1c	T	C	12: 103,897,080	K287R	probably benign	Het
Sgsm2	T	A	11: 74,892,028	H34L	probably damaging	Het
Slc38a4	A	G	15: 96,998,493	Y498H	probably damaging	Het
Ttn	T	A	2: 76,798,040	Y14592F	probably damaging	Het
Ube3b	T	C	5: 114,398,428	F245S	possibly damaging	Het
Ugt3a2	G	A	15: 9,335,793		probably null	Het
Wdr91	T	A	6: 34,904,522	S297C	possibly damaging	Het
Zcwpw2	T	C	9: 117,998,914		noncoding transcript	Het

Other mutations in Pkp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Pkp4	APN	2	59338755	missense	probably damaging	0.99
IGL00987:Pkp4	APN	2	59308357	missense	probably damaging	0.98
IGL01321:Pkp4	APN	2	59350627	splice site	probably null
IGL01393:Pkp4	APN	2	59347925	missense	probably damaging	1.00
IGL02058:Pkp4	APN	2	59311729	nonsense	probably null
IGL02313:Pkp4	APN	2	59310254	nonsense	probably null
IGL02635:Pkp4	APN	2	59305498	unclassified	probably benign
IGL03017:Pkp4	APN	2	59266425	missense	probably benign	0.06
IGL03051:Pkp4	APN	2	59311762	missense	probably benign	0.29
Degrasso	UTSW	2	59318600	missense	probably damaging	1.00
melted	UTSW	2	59334932	critical splice donor site	probably null
BB004:Pkp4	UTSW	2	59311754	missense	probably damaging	0.97
BB014:Pkp4	UTSW	2	59311754	missense	probably damaging	0.97
R0206:Pkp4	UTSW	2	59266436	missense	probably damaging	0.99
R0207:Pkp4	UTSW	2	59305488	missense	possibly damaging	0.89
R0208:Pkp4	UTSW	2	59266436	missense	probably damaging	0.99
R0325:Pkp4	UTSW	2	59318529	missense	probably damaging	1.00
R0620:Pkp4	UTSW	2	59322643	missense	possibly damaging	0.46
R0781:Pkp4	UTSW	2	59338765	missense	probably damaging	1.00
R1110:Pkp4	UTSW	2	59338765	missense	probably damaging	1.00
R1537:Pkp4	UTSW	2	59214803	missense	probably damaging	1.00
R1607:Pkp4	UTSW	2	59322554	missense	probably benign	0.00
R1654:Pkp4	UTSW	2	59337619	missense	probably damaging	0.96
R1760:Pkp4	UTSW	2	59311841	missense	probably damaging	0.97
R2051:Pkp4	UTSW	2	59334904	missense	probably benign	0.37
R2871:Pkp4	UTSW	2	59308156	missense	probably benign	0.35
R2871:Pkp4	UTSW	2	59308156	missense	probably benign	0.35
R3161:Pkp4	UTSW	2	59308105	missense	probably damaging	1.00
R4342:Pkp4	UTSW	2	59350608	missense	probably damaging	0.98
R4731:Pkp4	UTSW	2	59334932	critical splice donor site	probably null
R4799:Pkp4	UTSW	2	59342105	missense	probably damaging	1.00
R4913:Pkp4	UTSW	2	59305450	missense	probably damaging	1.00
R5383:Pkp4	UTSW	2	59310273	nonsense	probably null
R5418:Pkp4	UTSW	2	59310162	missense	probably benign	0.09
R5906:Pkp4	UTSW	2	59305076	missense	possibly damaging	0.79
R5946:Pkp4	UTSW	2	59305067	missense	probably benign	0.01
R6360:Pkp4	UTSW	2	59214747	missense	probably benign	0.01
R6616:Pkp4	UTSW	2	59350552	nonsense	probably null
R6817:Pkp4	UTSW	2	59318600	missense	probably damaging	1.00
R7390:Pkp4	UTSW	2	59310140	missense	possibly damaging	0.94
R7408:Pkp4	UTSW	2	59311766	missense	probably damaging	1.00
R7464:Pkp4	UTSW	2	59308137	missense	probably benign	0.12
R7702:Pkp4	UTSW	2	59308413	missense	probably damaging	0.99
R7787:Pkp4	UTSW	2	59322537	missense	probably damaging	0.98
R7927:Pkp4	UTSW	2	59311754	missense	probably damaging	0.97
R8055:Pkp4	UTSW	2	59308015	missense	probably benign
R8359:Pkp4	UTSW	2	59350551	missense	probably damaging	1.00
R8465:Pkp4	UTSW	2	59342181	missense	possibly damaging	0.90
R8555:Pkp4	UTSW	2	59308035	nonsense	probably null
R8909:Pkp4	UTSW	2	59354414	missense	possibly damaging	0.71
R9224:Pkp4	UTSW	2	59314394	missense	probably benign	0.41
R9397:Pkp4	UTSW	2	59318512	nonsense	probably null
R9486:Pkp4	UTSW	2	59308378	missense	probably benign	0.27
R9583:Pkp4	UTSW	2	59347760	missense	possibly damaging	0.80
R9732:Pkp4	UTSW	2	59308453	missense	possibly damaging	0.94
Z1176:Pkp4	UTSW	2	59342244	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCAGAGCCTATGGATTTCAGG -3'
(R):5'- CACTGTCAGAGTAAGAATTCATCTGTG -3'

Sequencing Primer
(F):5'- AGCCTATGGATTTCAGGATTCTATTG -3'
(R):5'- ATTCATCTGTGTTGAACTTCTTGAG -3'

Posted On

2015-06-20