Incidental Mutation 'R0001:Ctsb'
ID32264
Institutional Source Beutler Lab
Gene Symbol Ctsb
Ensembl Gene ENSMUSG00000021939
Gene Namecathepsin B
SynonymsCB
MMRRC Submission 038297-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R0001 (G1)
Quality Score196
Status Validated
Chromosome14
Chromosomal Location63122462-63145923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63135622 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 76 (E76G)
Ref Sequence ENSEMBL: ENSMUSP00000006235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006235]
Predicted Effect probably benign
Transcript: ENSMUST00000006235
AA Change: E76G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006235
Gene: ENSMUSG00000021939
AA Change: E76G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Propeptide_C1 26 65 5.4e-22 PFAM
Pept_C1 80 329 1.12e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225540
Meta Mutation Damage Score 0.0627 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the cathepsin B light and heavy chains, which can dimerize to generate the double chain form of the enzyme. This enzyme is a lysosomal cysteine protease with both endopeptidase and exopeptidase activity that may play a role in protein turnover. Homozygous knockout mice for this gene exhibit reduced pancreatic damage following induced pancreatitis and reduced hepatocyte apoptosis in a model of liver injury. Pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations are born normal without gross abnormalities. Homozygous mutant has resistance to induced pancreatitis. In combination with Ctsltm1Cptr, double homozygous mutant shows postnatal lethality due to wide neuronal degeneration in brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik G A 19: 58,789,171 A61V probably damaging Het
2900092C05Rik T A 7: 12,554,607 probably benign Het
A4galt A G 15: 83,228,289 F98L probably benign Het
Abca4 T G 3: 122,081,011 probably benign Het
Acacb C T 5: 114,204,833 probably benign Het
Agbl1 A T 7: 76,419,863 H367L probably damaging Het
Apoa4 C A 9: 46,242,892 Q264K probably benign Het
Camsap2 A T 1: 136,282,888 probably benign Het
Cdan1 C A 2: 120,723,751 R939L probably benign Het
Ceacam18 G A 7: 43,636,876 V58I possibly damaging Het
Ciita A T 16: 10,514,433 probably benign Het
Clk4 T A 11: 51,268,765 probably benign Het
Cntnap2 T C 6: 46,530,171 D215G probably benign Het
Col11a2 T C 17: 34,061,612 S1218P probably benign Het
Col20a1 T C 2: 180,984,412 probably benign Het
Ctu2 T C 8: 122,478,920 C161R probably benign Het
Dhx29 T C 13: 112,964,556 L1211P probably damaging Het
Dhx9 G T 1: 153,462,636 T759K probably damaging Het
Dmxl1 T C 18: 49,888,897 probably benign Het
Dpysl3 C T 18: 43,358,375 E226K possibly damaging Het
Eif2d A T 1: 131,168,127 K453* probably null Het
Epha7 T C 4: 28,961,279 probably benign Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fat3 T C 9: 16,377,873 D118G probably damaging Het
Foxn4 T A 5: 114,260,870 Q159L probably damaging Het
Frs2 G T 10: 117,074,876 H194N possibly damaging Het
Fut8 A T 12: 77,475,315 *576L probably null Het
Galns T C 8: 122,595,883 probably benign Het
Gamt G A 10: 80,259,061 probably benign Het
Gpn1 T A 5: 31,495,617 probably benign Het
Ipcef1 G T 10: 6,900,600 H330Q probably damaging Het
Itga4 A C 2: 79,326,587 Y1024S probably damaging Het
Jak2 A G 19: 29,282,387 I229V probably benign Het
Katnal1 A G 5: 148,921,275 S42P probably damaging Het
Kcnu1 A T 8: 25,859,270 D142V probably damaging Het
Lig3 C T 11: 82,790,591 R470W probably damaging Het
Mgat4c A G 10: 102,388,956 S344G probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 C T 12: 57,460,839 probably benign Het
Mki67 C T 7: 135,699,172 V1378M probably damaging Het
Mki67 T A 7: 135,701,019 D762V probably damaging Het
Mmp9 A G 2: 164,948,383 T43A probably benign Het
Muc6 T C 7: 141,641,574 T1316A possibly damaging Het
Naip5 A G 13: 100,214,650 probably null Het
Naip5 C A 13: 100,223,114 S538I probably benign Het
Nek3 A T 8: 22,158,612 probably benign Het
Nlrp1b A G 11: 71,161,759 S948P probably damaging Het
Nyap2 A T 1: 81,192,107 H193L probably benign Het
Olfr1413 A G 1: 92,573,461 K97E possibly damaging Het
Olfr648 T A 7: 104,179,473 K312* probably null Het
Patl2 G A 2: 122,125,710 probably benign Het
Pcdhb11 A T 18: 37,423,989 R791W probably benign Het
Pkd1l3 C A 8: 109,628,633 probably benign Het
Pkn2 A T 3: 142,828,988 V73D probably benign Het
Pknox1 A T 17: 31,599,636 H281L probably damaging Het
Polr3a A G 14: 24,452,189 probably benign Het
Prss38 A G 11: 59,373,180 probably benign Het
Rad54l2 A G 9: 106,708,217 F783S probably damaging Het
Rbm5 T C 9: 107,742,424 R125G probably damaging Het
Rnpep A G 1: 135,272,485 probably benign Het
Slc1a5 T A 7: 16,793,637 probably null Het
Slc22a4 G A 11: 54,028,003 probably benign Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Svep1 G A 4: 58,066,460 T3208I possibly damaging Het
Tgm5 G T 2: 121,077,646 D16E probably damaging Het
Tpp2 A G 1: 43,971,726 N558D probably benign Het
Trappc9 A T 15: 72,963,662 L507Q probably damaging Het
Trpm3 A T 19: 22,715,331 Q262L possibly damaging Het
Ttn A G 2: 76,776,972 probably benign Het
Ttn G A 2: 76,832,089 probably benign Het
Ubr4 T A 4: 139,451,788 L3316Q probably damaging Het
Uckl1 T A 2: 181,574,655 Y136F probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps39 A G 2: 120,318,053 V870A probably benign Het
Zdhhc25 A G 15: 88,600,909 D149G probably benign Het
Zfp648 C T 1: 154,205,286 T397M probably damaging Het
Zic2 C A 14: 122,478,957 T435K probably damaging Het
Other mutations in Ctsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Ctsb APN 14 63135650 missense probably damaging 0.99
IGL02565:Ctsb APN 14 63138410 missense probably null 1.00
IGL03011:Ctsb APN 14 63133357 missense probably benign 0.13
R1226:Ctsb UTSW 14 63141740 missense probably damaging 1.00
R1241:Ctsb UTSW 14 63139104 missense probably benign 0.28
R1533:Ctsb UTSW 14 63139095 missense probably damaging 1.00
R4179:Ctsb UTSW 14 63133452 missense probably benign 0.01
R6042:Ctsb UTSW 14 63141856 missense probably damaging 1.00
R6396:Ctsb UTSW 14 63138101 missense probably benign 0.04
R7422:Ctsb UTSW 14 63142303 missense probably benign 0.00
R7472:Ctsb UTSW 14 63138101 missense probably benign 0.04
R7573:Ctsb UTSW 14 63138101 missense probably benign 0.04
R7721:Ctsb UTSW 14 63133316 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TGCACATGATGCTGAGTCACTCTG -3'
(R):5'- GCAATAATTTCCGACCACGAGGACC -3'

Sequencing Primer
(F):5'- TGCTGAGTCACTCTGAACAG -3'
(R):5'- CCACAAACCACAGTGATGGG -3'
Posted On2013-05-09