Incidental Mutation 'R4261:Dock7'
ID 322645
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Name dedicator of cytokinesis 7
Synonyms m, LOC242555, 3110056M06Rik
MMRRC Submission 041074-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4261 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 98824908-99009152 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 98892123 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 821 (M821K)
Ref Sequence ENSEMBL: ENSMUSP00000145604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000127946] [ENSMUST00000205650]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000030286
AA Change: M821K

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: M821K

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000075836
AA Change: M821K
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: M821K

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124466
AA Change: M237K
Predicted Effect unknown
Transcript: ENSMUST00000127417
AA Change: M821K
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: M821K

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000127946
AA Change: M94K
SMART Domains Protein: ENSMUSP00000119103
Gene: ENSMUSG00000028556
AA Change: M94K

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
low complexity region 155 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153362
Predicted Effect possibly damaging
Transcript: ENSMUST00000205650
AA Change: M821K

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect unknown
Transcript: ENSMUST00000150254
AA Change: M105K
SMART Domains Protein: ENSMUSP00000114204
Gene: ENSMUSG00000028556
AA Change: M105K

DomainStartEndE-ValueType
low complexity region 74 84 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
Meta Mutation Damage Score 0.7826 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,214,066 (GRCm39) S298P probably damaging Het
4930407I10Rik A G 15: 81,947,927 (GRCm39) D608G possibly damaging Het
Actr10 T C 12: 70,999,759 (GRCm39) V185A probably benign Het
Adam9 G A 8: 25,454,923 (GRCm39) Q733* probably null Het
Adamts4 C T 1: 171,086,673 (GRCm39) P822S probably benign Het
Arhgap9 G C 10: 127,164,334 (GRCm39) R537P probably damaging Het
Bsn T A 9: 107,987,883 (GRCm39) probably benign Het
Car5a A T 8: 122,671,488 (GRCm39) H15Q probably benign Het
Disp1 A T 1: 182,870,950 (GRCm39) I490N probably damaging Het
Dlgap5 T G 14: 47,651,245 (GRCm39) Y96S probably damaging Het
Dnah10 T A 5: 124,807,201 (GRCm39) V162D possibly damaging Het
Exoc3l T C 8: 106,017,599 (GRCm39) R528G probably damaging Het
Fam234b G A 6: 135,186,134 (GRCm39) G17E unknown Het
Grhl2 G A 15: 37,361,067 (GRCm39) G617D possibly damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,355,630 (GRCm39) probably null Het
Hoxd9 C A 2: 74,526,031 (GRCm39) probably benign Het
Hspa9 A G 18: 35,072,476 (GRCm39) S550P probably damaging Het
Ide A C 19: 37,306,585 (GRCm39) S63A unknown Het
Kat6b T A 14: 21,719,737 (GRCm39) I1363N probably damaging Het
Ltbp1 T A 17: 75,598,362 (GRCm39) C614* probably null Het
Mphosph8 A G 14: 56,911,922 (GRCm39) D315G probably benign Het
Mthfr-ps1 A C 5: 78,622,330 (GRCm39) noncoding transcript Het
Mug1 A G 6: 121,850,693 (GRCm39) T730A probably benign Het
Myef2 T C 2: 124,957,399 (GRCm39) T119A possibly damaging Het
Pald1 A G 10: 61,179,471 (GRCm39) L466P probably damaging Het
Pcdh15 G A 10: 74,481,512 (GRCm39) V286M probably damaging Het
Pcdhgb2 A G 18: 37,824,950 (GRCm39) D647G probably damaging Het
Pdgfrb A C 18: 61,210,703 (GRCm39) T737P probably benign Het
Pgk2 T G 17: 40,518,274 (GRCm39) T385P probably benign Het
Pkp4 A G 2: 59,135,506 (GRCm39) Y126C probably damaging Het
Plppr1 A G 4: 49,300,993 (GRCm39) I109V probably benign Het
Ppcs A G 4: 119,279,106 (GRCm39) F149L probably damaging Het
Ppp2r5d G A 17: 46,998,007 (GRCm39) Q219* probably null Het
Raf1 C T 6: 115,600,015 (GRCm39) probably null Het
Rfx7 C T 9: 72,523,925 (GRCm39) R372W probably damaging Het
Robo4 C A 9: 37,316,877 (GRCm39) S397R probably benign Het
Sat1 T C X: 153,998,182 (GRCm39) probably benign Het
Serpina1c T C 12: 103,863,339 (GRCm39) K287R probably benign Het
Sgsm2 T A 11: 74,782,854 (GRCm39) H34L probably damaging Het
Slc38a4 A G 15: 96,896,374 (GRCm39) Y498H probably damaging Het
Ttn T A 2: 76,628,384 (GRCm39) Y14592F probably damaging Het
Ube3b T C 5: 114,536,489 (GRCm39) F245S possibly damaging Het
Ugt3a1 G A 15: 9,335,879 (GRCm39) probably null Het
Wdr91 T A 6: 34,881,457 (GRCm39) S297C possibly damaging Het
Zcwpw2 T C 9: 117,827,982 (GRCm39) noncoding transcript Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 98,952,222 (GRCm39) missense probably damaging 1.00
IGL01126:Dock7 APN 4 98,861,789 (GRCm39) splice site probably benign
IGL01490:Dock7 APN 4 98,833,355 (GRCm39) unclassified probably benign
IGL01553:Dock7 APN 4 98,833,803 (GRCm39) nonsense probably null
IGL01728:Dock7 APN 4 98,850,568 (GRCm39) missense probably damaging 1.00
IGL01776:Dock7 APN 4 98,829,178 (GRCm39) missense possibly damaging 0.65
IGL01954:Dock7 APN 4 98,971,388 (GRCm39) missense probably damaging 0.99
IGL01985:Dock7 APN 4 98,911,614 (GRCm39) missense probably benign 0.35
IGL02054:Dock7 APN 4 98,861,646 (GRCm39) missense probably damaging 1.00
IGL02150:Dock7 APN 4 98,968,089 (GRCm39) splice site probably benign
IGL02153:Dock7 APN 4 98,846,304 (GRCm39) missense probably benign 0.15
IGL02183:Dock7 APN 4 98,847,228 (GRCm39) missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98,877,471 (GRCm39) missense probably benign 0.18
IGL02618:Dock7 APN 4 98,971,265 (GRCm39) missense probably benign 0.00
IGL02634:Dock7 APN 4 98,877,533 (GRCm39) missense probably damaging 1.00
IGL02670:Dock7 APN 4 98,854,523 (GRCm39) splice site probably null
IGL02690:Dock7 APN 4 98,857,872 (GRCm39) missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98,875,623 (GRCm39) missense probably damaging 1.00
IGL02833:Dock7 APN 4 98,833,732 (GRCm39) missense probably damaging 1.00
IGL02858:Dock7 APN 4 98,833,442 (GRCm39) nonsense probably null
IGL02875:Dock7 APN 4 98,864,231 (GRCm39) missense probably benign 0.00
IGL03027:Dock7 APN 4 98,958,450 (GRCm39) missense possibly damaging 0.71
IGL03027:Dock7 APN 4 98,866,164 (GRCm39) missense probably benign
IGL03032:Dock7 APN 4 98,854,585 (GRCm39) missense probably benign 0.02
IGL03104:Dock7 APN 4 98,847,260 (GRCm39) missense possibly damaging 0.60
IGL03136:Dock7 APN 4 98,892,028 (GRCm39) missense probably damaging 1.00
IGL03345:Dock7 APN 4 98,873,056 (GRCm39) missense possibly damaging 0.91
Beaming UTSW 4 98,967,992 (GRCm39) nonsense probably null
moonlight UTSW 4 0 () large deletion
Nocturn UTSW 4 98,952,199 (GRCm39) missense probably benign 0.00
sonata UTSW 4 98,889,364 (GRCm39) nonsense probably null
BB005:Dock7 UTSW 4 98,889,335 (GRCm39) missense
BB015:Dock7 UTSW 4 98,889,335 (GRCm39) missense
PIT4810001:Dock7 UTSW 4 98,833,796 (GRCm39) nonsense probably null
R0086:Dock7 UTSW 4 98,833,381 (GRCm39) missense probably damaging 1.00
R0242:Dock7 UTSW 4 98,850,517 (GRCm39) missense probably benign
R0242:Dock7 UTSW 4 98,850,517 (GRCm39) missense probably benign
R0245:Dock7 UTSW 4 98,943,586 (GRCm39) missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98,873,051 (GRCm39) missense probably benign 0.07
R0556:Dock7 UTSW 4 98,833,426 (GRCm39) missense probably damaging 1.00
R0612:Dock7 UTSW 4 98,877,470 (GRCm39) missense probably benign 0.31
R0652:Dock7 UTSW 4 98,943,586 (GRCm39) missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98,875,716 (GRCm39) missense probably benign 0.00
R0681:Dock7 UTSW 4 98,904,941 (GRCm39) missense probably damaging 1.00
R0725:Dock7 UTSW 4 98,833,528 (GRCm39) missense probably damaging 1.00
R0828:Dock7 UTSW 4 98,903,982 (GRCm39) missense probably damaging 1.00
R0837:Dock7 UTSW 4 98,877,495 (GRCm39) missense probably benign 0.01
R0962:Dock7 UTSW 4 98,833,432 (GRCm39) missense possibly damaging 0.85
R1140:Dock7 UTSW 4 98,953,643 (GRCm39) missense possibly damaging 0.82
R1476:Dock7 UTSW 4 98,967,672 (GRCm39) missense possibly damaging 0.52
R1614:Dock7 UTSW 4 98,949,517 (GRCm39) missense probably benign 0.12
R1625:Dock7 UTSW 4 98,850,433 (GRCm39) splice site probably null
R1640:Dock7 UTSW 4 98,833,483 (GRCm39) missense probably damaging 1.00
R1752:Dock7 UTSW 4 98,854,681 (GRCm39) missense probably damaging 1.00
R1941:Dock7 UTSW 4 98,872,952 (GRCm39) missense probably benign 0.09
R2020:Dock7 UTSW 4 98,847,338 (GRCm39) missense probably damaging 1.00
R2092:Dock7 UTSW 4 98,897,545 (GRCm39) missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98,854,606 (GRCm39) missense probably damaging 1.00
R2424:Dock7 UTSW 4 98,833,544 (GRCm39) nonsense probably null
R3767:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3768:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3769:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3770:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3917:Dock7 UTSW 4 98,904,922 (GRCm39) missense probably damaging 1.00
R3943:Dock7 UTSW 4 98,880,668 (GRCm39) missense probably damaging 1.00
R4021:Dock7 UTSW 4 98,892,157 (GRCm39) splice site probably null
R4073:Dock7 UTSW 4 98,896,296 (GRCm39) missense probably benign 0.02
R4170:Dock7 UTSW 4 98,854,638 (GRCm39) missense probably damaging 0.99
R4180:Dock7 UTSW 4 98,904,973 (GRCm39) missense probably benign 0.05
R4321:Dock7 UTSW 4 98,960,691 (GRCm39) missense probably damaging 1.00
R4522:Dock7 UTSW 4 98,850,461 (GRCm39) missense probably damaging 1.00
R4582:Dock7 UTSW 4 98,892,153 (GRCm39) missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98,857,881 (GRCm39) nonsense probably null
R4940:Dock7 UTSW 4 98,908,314 (GRCm39) missense probably damaging 1.00
R5090:Dock7 UTSW 4 98,879,648 (GRCm39) missense probably benign 0.04
R5374:Dock7 UTSW 4 98,877,275 (GRCm39) missense possibly damaging 0.81
R5392:Dock7 UTSW 4 98,896,243 (GRCm39) missense probably damaging 1.00
R5527:Dock7 UTSW 4 98,842,105 (GRCm39) intron probably benign
R5544:Dock7 UTSW 4 98,855,494 (GRCm39) missense probably damaging 1.00
R5556:Dock7 UTSW 4 98,832,972 (GRCm39) missense probably damaging 1.00
R5870:Dock7 UTSW 4 98,952,199 (GRCm39) missense probably benign 0.00
R5899:Dock7 UTSW 4 98,879,660 (GRCm39) missense probably benign
R6360:Dock7 UTSW 4 98,857,899 (GRCm39) missense probably benign 0.02
R6415:Dock7 UTSW 4 98,880,685 (GRCm39) missense probably damaging 1.00
R6468:Dock7 UTSW 4 98,855,464 (GRCm39) missense probably benign 0.15
R6562:Dock7 UTSW 4 98,879,647 (GRCm39) missense probably damaging 0.97
R6613:Dock7 UTSW 4 98,866,197 (GRCm39) missense probably damaging 0.99
R6703:Dock7 UTSW 4 98,834,909 (GRCm39) missense probably damaging 1.00
R6723:Dock7 UTSW 4 98,892,153 (GRCm39) missense possibly damaging 0.90
R6786:Dock7 UTSW 4 98,949,529 (GRCm39) missense probably benign 0.42
R7026:Dock7 UTSW 4 98,967,156 (GRCm39) missense probably benign
R7051:Dock7 UTSW 4 98,834,969 (GRCm39) missense probably damaging 1.00
R7074:Dock7 UTSW 4 98,833,445 (GRCm39) missense unknown
R7106:Dock7 UTSW 4 98,855,563 (GRCm39) missense unknown
R7147:Dock7 UTSW 4 98,849,654 (GRCm39) missense unknown
R7257:Dock7 UTSW 4 98,861,649 (GRCm39) missense unknown
R7334:Dock7 UTSW 4 98,864,180 (GRCm39) missense unknown
R7511:Dock7 UTSW 4 98,967,992 (GRCm39) nonsense probably null
R7511:Dock7 UTSW 4 98,949,519 (GRCm39) missense
R7729:Dock7 UTSW 4 98,943,683 (GRCm39) missense
R7928:Dock7 UTSW 4 98,889,335 (GRCm39) missense
R7984:Dock7 UTSW 4 98,877,303 (GRCm39) missense unknown
R8287:Dock7 UTSW 4 98,866,157 (GRCm39) missense unknown
R8439:Dock7 UTSW 4 98,971,266 (GRCm39) missense
R8466:Dock7 UTSW 4 98,952,336 (GRCm39) missense possibly damaging 0.70
R8758:Dock7 UTSW 4 98,949,555 (GRCm39) missense
R8849:Dock7 UTSW 4 98,904,986 (GRCm39) missense
R8944:Dock7 UTSW 4 98,829,243 (GRCm39) missense probably damaging 1.00
R8964:Dock7 UTSW 4 98,949,476 (GRCm39) missense
R9008:Dock7 UTSW 4 98,833,448 (GRCm39) nonsense probably null
R9040:Dock7 UTSW 4 98,889,364 (GRCm39) nonsense probably null
R9160:Dock7 UTSW 4 98,857,962 (GRCm39) missense unknown
R9168:Dock7 UTSW 4 98,953,643 (GRCm39) missense
R9189:Dock7 UTSW 4 98,877,350 (GRCm39) missense unknown
R9215:Dock7 UTSW 4 98,859,088 (GRCm39) missense unknown
R9243:Dock7 UTSW 4 98,857,871 (GRCm39) missense unknown
R9256:Dock7 UTSW 4 98,971,272 (GRCm39) missense
R9328:Dock7 UTSW 4 98,968,064 (GRCm39) missense
R9332:Dock7 UTSW 4 98,896,280 (GRCm39) missense
R9450:Dock7 UTSW 4 98,861,426 (GRCm39) missense unknown
R9584:Dock7 UTSW 4 98,861,481 (GRCm39) nonsense probably null
R9631:Dock7 UTSW 4 98,854,560 (GRCm39) missense unknown
R9676:Dock7 UTSW 4 98,904,922 (GRCm39) missense probably damaging 1.00
R9701:Dock7 UTSW 4 98,846,384 (GRCm39) missense unknown
R9723:Dock7 UTSW 4 98,960,660 (GRCm39) missense
R9723:Dock7 UTSW 4 98,908,270 (GRCm39) missense
R9727:Dock7 UTSW 4 98,875,568 (GRCm39) missense unknown
R9777:Dock7 UTSW 4 98,877,464 (GRCm39) missense unknown
R9802:Dock7 UTSW 4 98,846,384 (GRCm39) missense unknown
X0027:Dock7 UTSW 4 98,892,090 (GRCm39) missense probably damaging 0.99
Z1176:Dock7 UTSW 4 98,833,462 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGTCTTGGCAAGAACACTTCACG -3'
(R):5'- CACTCTTGAGGTTGTCTATAAGATGG -3'

Sequencing Primer
(F):5'- CACTTCACGAAAGAGAGTTTAGTAC -3'
(R):5'- TGTGCTTTGTTACCTGTCAAAATAG -3'
Posted On 2015-06-20