Incidental Mutation 'R0001:Zic2'
ID32265
Institutional Source Beutler Lab
Gene Symbol Zic2
Ensembl Gene ENSMUSG00000061524
Gene Namezinc finger protein of the cerebellum 2
Synonymsodd-paired homolog, GENA 29, Ku
MMRRC Submission 038297-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R0001 (G1)
Quality Score210
Status Validated
Chromosome14
Chromosomal Location122475435-122479852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 122478957 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 435 (T435K)
Ref Sequence ENSEMBL: ENSMUSP00000075283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075888]
Predicted Effect probably damaging
Transcript: ENSMUST00000075888
AA Change: T435K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524
AA Change: T435K

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 131 150 N/A INTRINSIC
low complexity region 215 241 N/A INTRINSIC
ZnF_C2H2 265 290 5.68e1 SMART
ZnF_C2H2 299 326 6.92e0 SMART
ZnF_C2H2 332 356 8.02e-5 SMART
ZnF_C2H2 362 386 1.69e-3 SMART
ZnF_C2H2 392 414 4.54e-4 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 455 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177306
Meta Mutation Damage Score 0.2831 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik G A 19: 58,789,171 A61V probably damaging Het
2900092C05Rik T A 7: 12,554,607 probably benign Het
A4galt A G 15: 83,228,289 F98L probably benign Het
Abca4 T G 3: 122,081,011 probably benign Het
Acacb C T 5: 114,204,833 probably benign Het
Agbl1 A T 7: 76,419,863 H367L probably damaging Het
Apoa4 C A 9: 46,242,892 Q264K probably benign Het
Camsap2 A T 1: 136,282,888 probably benign Het
Cdan1 C A 2: 120,723,751 R939L probably benign Het
Ceacam18 G A 7: 43,636,876 V58I possibly damaging Het
Ciita A T 16: 10,514,433 probably benign Het
Clk4 T A 11: 51,268,765 probably benign Het
Cntnap2 T C 6: 46,530,171 D215G probably benign Het
Col11a2 T C 17: 34,061,612 S1218P probably benign Het
Col20a1 T C 2: 180,984,412 probably benign Het
Ctsb A G 14: 63,135,622 E76G probably benign Het
Ctu2 T C 8: 122,478,920 C161R probably benign Het
Dhx29 T C 13: 112,964,556 L1211P probably damaging Het
Dhx9 G T 1: 153,462,636 T759K probably damaging Het
Dmxl1 T C 18: 49,888,897 probably benign Het
Dpysl3 C T 18: 43,358,375 E226K possibly damaging Het
Eif2d A T 1: 131,168,127 K453* probably null Het
Epha7 T C 4: 28,961,279 probably benign Het
Fam160b1 T A 19: 57,381,756 H477Q probably benign Het
Fat3 T C 9: 16,377,873 D118G probably damaging Het
Foxn4 T A 5: 114,260,870 Q159L probably damaging Het
Frs2 G T 10: 117,074,876 H194N possibly damaging Het
Fut8 A T 12: 77,475,315 *576L probably null Het
Galns T C 8: 122,595,883 probably benign Het
Gamt G A 10: 80,259,061 probably benign Het
Gpn1 T A 5: 31,495,617 probably benign Het
Ipcef1 G T 10: 6,900,600 H330Q probably damaging Het
Itga4 A C 2: 79,326,587 Y1024S probably damaging Het
Jak2 A G 19: 29,282,387 I229V probably benign Het
Katnal1 A G 5: 148,921,275 S42P probably damaging Het
Kcnu1 A T 8: 25,859,270 D142V probably damaging Het
Lig3 C T 11: 82,790,591 R470W probably damaging Het
Mgat4c A G 10: 102,388,956 S344G probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 C T 12: 57,460,839 probably benign Het
Mki67 C T 7: 135,699,172 V1378M probably damaging Het
Mki67 T A 7: 135,701,019 D762V probably damaging Het
Mmp9 A G 2: 164,948,383 T43A probably benign Het
Muc6 T C 7: 141,641,574 T1316A possibly damaging Het
Naip5 A G 13: 100,214,650 probably null Het
Naip5 C A 13: 100,223,114 S538I probably benign Het
Nek3 A T 8: 22,158,612 probably benign Het
Nlrp1b A G 11: 71,161,759 S948P probably damaging Het
Nyap2 A T 1: 81,192,107 H193L probably benign Het
Olfr1413 A G 1: 92,573,461 K97E possibly damaging Het
Olfr648 T A 7: 104,179,473 K312* probably null Het
Patl2 G A 2: 122,125,710 probably benign Het
Pcdhb11 A T 18: 37,423,989 R791W probably benign Het
Pkd1l3 C A 8: 109,628,633 probably benign Het
Pkn2 A T 3: 142,828,988 V73D probably benign Het
Pknox1 A T 17: 31,599,636 H281L probably damaging Het
Polr3a A G 14: 24,452,189 probably benign Het
Prss38 A G 11: 59,373,180 probably benign Het
Rad54l2 A G 9: 106,708,217 F783S probably damaging Het
Rbm5 T C 9: 107,742,424 R125G probably damaging Het
Rnpep A G 1: 135,272,485 probably benign Het
Slc1a5 T A 7: 16,793,637 probably null Het
Slc22a4 G A 11: 54,028,003 probably benign Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Svep1 G A 4: 58,066,460 T3208I possibly damaging Het
Tgm5 G T 2: 121,077,646 D16E probably damaging Het
Tpp2 A G 1: 43,971,726 N558D probably benign Het
Trappc9 A T 15: 72,963,662 L507Q probably damaging Het
Trpm3 A T 19: 22,715,331 Q262L possibly damaging Het
Ttn A G 2: 76,776,972 probably benign Het
Ttn G A 2: 76,832,089 probably benign Het
Ubr4 T A 4: 139,451,788 L3316Q probably damaging Het
Uckl1 T A 2: 181,574,655 Y136F probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps39 A G 2: 120,318,053 V870A probably benign Het
Zdhhc25 A G 15: 88,600,909 D149G probably benign Het
Zfp648 C T 1: 154,205,286 T397M probably damaging Het
Other mutations in Zic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Zic2 APN 14 122478559 nonsense probably null
IGL01607:Zic2 APN 14 122478882 splice site probably benign
IGL02307:Zic2 APN 14 122476634 missense possibly damaging 0.76
IGL02311:Zic2 APN 14 122476194 missense probably damaging 0.99
IGL02561:Zic2 APN 14 122478545 nonsense probably null
IGL02982:Zic2 APN 14 122478567 missense probably damaging 0.98
R0027:Zic2 UTSW 14 122476343 missense possibly damaging 0.77
R0136:Zic2 UTSW 14 122476541 missense probably damaging 0.96
R0310:Zic2 UTSW 14 122476364 small deletion probably benign
R0418:Zic2 UTSW 14 122476364 small deletion probably benign
R0420:Zic2 UTSW 14 122476364 small deletion probably benign
R0421:Zic2 UTSW 14 122476364 small deletion probably benign
R0518:Zic2 UTSW 14 122476364 small deletion probably benign
R0520:Zic2 UTSW 14 122476364 small deletion probably benign
R0521:Zic2 UTSW 14 122476364 small deletion probably benign
R0628:Zic2 UTSW 14 122476364 small deletion probably benign
R1733:Zic2 UTSW 14 122478947 missense probably damaging 0.97
R1757:Zic2 UTSW 14 122478619 missense possibly damaging 0.86
R2398:Zic2 UTSW 14 122478917 nonsense probably null
R5323:Zic2 UTSW 14 122476316 missense probably damaging 1.00
R5381:Zic2 UTSW 14 122475815 missense probably damaging 0.97
R6930:Zic2 UTSW 14 122476457 missense probably damaging 0.99
R7223:Zic2 UTSW 14 122476091 missense probably damaging 0.98
Z1088:Zic2 UTSW 14 122478675 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGACAAGTCCTACACGCATCCC -3'
(R):5'- TAAGACGATCCTAAGGTGCCCTCG -3'

Sequencing Primer
(F):5'- GCATCCCAGCTCGTTGC -3'
(R):5'- CTCCGGTTGTCccgctg -3'
Posted On2013-05-09