Mutagenetix > Incidental Mutations

Incidental Mutation 'R0001:Zic2'

32265

Institutional Source

Beutler Lab

Gene Symbol

Zic2

Ensembl Gene

ENSMUSG00000061524

Gene Name

zinc finger protein of the cerebellum 2

Synonyms

odd-paired homolog, GENA 29, Ku

MMRRC Submission

038297-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.908) question?

Stock #

R0001 (G1)

Quality Score

210

Status

Validated

Chromosome

Chromosomal Location

122475435-122479852 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 122478957 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 435 (T435K)

Ref Sequence

ENSEMBL: ENSMUSP00000075283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075888]

Predicted Effect

probably damaging
Transcript: ENSMUST00000075888
AA Change: T435K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524
AA Change: T435K

Domain	Start	End	E-Value	Type
low complexity region	18	33	N/A	INTRINSIC
low complexity region	81	103	N/A	INTRINSIC
low complexity region	131	150	N/A	INTRINSIC
low complexity region	215	241	N/A	INTRINSIC
ZnF_C2H2	265	290	5.68e1	SMART
ZnF_C2H2	299	326	6.92e0	SMART
ZnF_C2H2	332	356	8.02e-5	SMART
ZnF_C2H2	362	386	1.69e-3	SMART
ZnF_C2H2	392	414	4.54e-4	SMART
low complexity region	416	434	N/A	INTRINSIC
low complexity region	455	519	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137059

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177306

Meta Mutation Damage Score

0.2831

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019N19Rik	G	A	19: 58,789,171	A61V	probably damaging	Het
2900092C05Rik	T	A	7: 12,554,607		probably benign	Het
A4galt	A	G	15: 83,228,289	F98L	probably benign	Het
Abca4	T	G	3: 122,081,011		probably benign	Het
Acacb	C	T	5: 114,204,833		probably benign	Het
Agbl1	A	T	7: 76,419,863	H367L	probably damaging	Het
Apoa4	C	A	9: 46,242,892	Q264K	probably benign	Het
Camsap2	A	T	1: 136,282,888		probably benign	Het
Cdan1	C	A	2: 120,723,751	R939L	probably benign	Het
Ceacam18	G	A	7: 43,636,876	V58I	possibly damaging	Het
Ciita	A	T	16: 10,514,433		probably benign	Het
Clk4	T	A	11: 51,268,765		probably benign	Het
Cntnap2	T	C	6: 46,530,171	D215G	probably benign	Het
Col11a2	T	C	17: 34,061,612	S1218P	probably benign	Het
Col20a1	T	C	2: 180,984,412		probably benign	Het
Ctsb	A	G	14: 63,135,622	E76G	probably benign	Het
Ctu2	T	C	8: 122,478,920	C161R	probably benign	Het
Dhx29	T	C	13: 112,964,556	L1211P	probably damaging	Het
Dhx9	G	T	1: 153,462,636	T759K	probably damaging	Het
Dmxl1	T	C	18: 49,888,897		probably benign	Het
Dpysl3	C	T	18: 43,358,375	E226K	possibly damaging	Het
Eif2d	A	T	1: 131,168,127	K453*	probably null	Het
Epha7	T	C	4: 28,961,279		probably benign	Het
Fam160b1	T	A	19: 57,381,756	H477Q	probably benign	Het
Fat3	T	C	9: 16,377,873	D118G	probably damaging	Het
Foxn4	T	A	5: 114,260,870	Q159L	probably damaging	Het
Frs2	G	T	10: 117,074,876	H194N	possibly damaging	Het
Fut8	A	T	12: 77,475,315	*576L	probably null	Het
Galns	T	C	8: 122,595,883		probably benign	Het
Gamt	G	A	10: 80,259,061		probably benign	Het
Gpn1	T	A	5: 31,495,617		probably benign	Het
Ipcef1	G	T	10: 6,900,600	H330Q	probably damaging	Het
Itga4	A	C	2: 79,326,587	Y1024S	probably damaging	Het
Jak2	A	G	19: 29,282,387	I229V	probably benign	Het
Katnal1	A	G	5: 148,921,275	S42P	probably damaging	Het
Kcnu1	A	T	8: 25,859,270	D142V	probably damaging	Het
Lig3	C	T	11: 82,790,591	R470W	probably damaging	Het
Mgat4c	A	G	10: 102,388,956	S344G	probably benign	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Mipol1	C	T	12: 57,460,839		probably benign	Het
Mki67	C	T	7: 135,699,172	V1378M	probably damaging	Het
Mki67	T	A	7: 135,701,019	D762V	probably damaging	Het
Mmp9	A	G	2: 164,948,383	T43A	probably benign	Het
Muc6	T	C	7: 141,641,574	T1316A	possibly damaging	Het
Naip5	A	G	13: 100,214,650		probably null	Het
Naip5	C	A	13: 100,223,114	S538I	probably benign	Het
Nek3	A	T	8: 22,158,612		probably benign	Het
Nlrp1b	A	G	11: 71,161,759	S948P	probably damaging	Het
Nyap2	A	T	1: 81,192,107	H193L	probably benign	Het
Olfr1413	A	G	1: 92,573,461	K97E	possibly damaging	Het
Olfr648	T	A	7: 104,179,473	K312*	probably null	Het
Patl2	G	A	2: 122,125,710		probably benign	Het
Pcdhb11	A	T	18: 37,423,989	R791W	probably benign	Het
Pkd1l3	C	A	8: 109,628,633		probably benign	Het
Pkn2	A	T	3: 142,828,988	V73D	probably benign	Het
Pknox1	A	T	17: 31,599,636	H281L	probably damaging	Het
Polr3a	A	G	14: 24,452,189		probably benign	Het
Prss38	A	G	11: 59,373,180		probably benign	Het
Rad54l2	A	G	9: 106,708,217	F783S	probably damaging	Het
Rbm5	T	C	9: 107,742,424	R125G	probably damaging	Het
Rnpep	A	G	1: 135,272,485		probably benign	Het
Slc1a5	T	A	7: 16,793,637		probably null	Het
Slc22a4	G	A	11: 54,028,003		probably benign	Het
Spink12	T	C	18: 44,107,696	C50R	probably damaging	Het
Svep1	G	A	4: 58,066,460	T3208I	possibly damaging	Het
Tgm5	G	T	2: 121,077,646	D16E	probably damaging	Het
Tpp2	A	G	1: 43,971,726	N558D	probably benign	Het
Trappc9	A	T	15: 72,963,662	L507Q	probably damaging	Het
Trpm3	A	T	19: 22,715,331	Q262L	possibly damaging	Het
Ttn	A	G	2: 76,776,972		probably benign	Het
Ttn	G	A	2: 76,832,089		probably benign	Het
Ubr4	T	A	4: 139,451,788	L3316Q	probably damaging	Het
Uckl1	T	A	2: 181,574,655	Y136F	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vps39	A	G	2: 120,318,053	V870A	probably benign	Het
Zdhhc25	A	G	15: 88,600,909	D149G	probably benign	Het
Zfp648	C	T	1: 154,205,286	T397M	probably damaging	Het

Other mutations in Zic2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00816:Zic2	APN	14	122478559	nonsense	probably null
IGL01607:Zic2	APN	14	122478882	splice site	probably benign
IGL02307:Zic2	APN	14	122476634	missense	possibly damaging	0.76
IGL02311:Zic2	APN	14	122476194	missense	probably damaging	0.99
IGL02561:Zic2	APN	14	122478545	nonsense	probably null
IGL02982:Zic2	APN	14	122478567	missense	probably damaging	0.98
R0027:Zic2	UTSW	14	122476343	missense	possibly damaging	0.77
R0136:Zic2	UTSW	14	122476541	missense	probably damaging	0.96
R0310:Zic2	UTSW	14	122476364	small deletion	probably benign
R0418:Zic2	UTSW	14	122476364	small deletion	probably benign
R0420:Zic2	UTSW	14	122476364	small deletion	probably benign
R0421:Zic2	UTSW	14	122476364	small deletion	probably benign
R0518:Zic2	UTSW	14	122476364	small deletion	probably benign
R0520:Zic2	UTSW	14	122476364	small deletion	probably benign
R0521:Zic2	UTSW	14	122476364	small deletion	probably benign
R0628:Zic2	UTSW	14	122476364	small deletion	probably benign
R1733:Zic2	UTSW	14	122478947	missense	probably damaging	0.97
R1757:Zic2	UTSW	14	122478619	missense	possibly damaging	0.86
R2398:Zic2	UTSW	14	122478917	nonsense	probably null
R5323:Zic2	UTSW	14	122476316	missense	probably damaging	1.00
R5381:Zic2	UTSW	14	122475815	missense	probably damaging	0.97
R6930:Zic2	UTSW	14	122476457	missense	probably damaging	0.99
R7223:Zic2	UTSW	14	122476091	missense	probably damaging	0.98
Z1088:Zic2	UTSW	14	122478675	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGTGACAAGTCCTACACGCATCCC -3'
(R):5'- TAAGACGATCCTAAGGTGCCCTCG -3'

Sequencing Primer
(F):5'- GCATCCCAGCTCGTTGC -3'
(R):5'- CTCCGGTTGTCccgctg -3'

Posted On

2013-05-09