Incidental Mutation 'R4261:Car5a'
ID322656
Institutional Source Beutler Lab
Gene Symbol Car5a
Ensembl Gene ENSMUSG00000025317
Gene Namecarbonic anhydrase 5a, mitochondrial
SynonymsCar5
MMRRC Submission 041074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R4261 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location121916126-121944904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121944749 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 15 (H15Q)
Ref Sequence ENSEMBL: ENSMUSP00000060457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057653] [ENSMUST00000127664]
PDB Structure
MURINE MITOCHONDRIAL CARBONIC ANYHDRASE V AT 2.45 ANGSTROMS RESOLUTION [X-RAY DIFFRACTION]
COMPLEX BETWEEN MURINE MITOCHONDRIAL CARBONIC ANYHDRASE V AND THE TRANSITION STATE ANALOGUE ACETAZOLAMIDE [X-RAY DIFFRACTION]
Crystal Structure of F65A/Y131C Carbonic Anhydrase V, covalently modified with 4-chloromethylimidazole [X-RAY DIFFRACTION]
MURINE CARBONIC ANHYDRASE V [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000057653
AA Change: H15Q

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000060457
Gene: ENSMUSG00000025317
AA Change: H15Q

DomainStartEndE-ValueType
Carb_anhydrase 27 290 6.61e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195830
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA VA is localized in the mitochondria and expressed primarily in the liver. It may play an important role in ureagenesis and gluconeogenesis. CA5A gene maps to chromosome 16q24.3 and an unprocessed pseudogene has been assigned to 16p12-p11.2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, hyperammonemia, and increased levels of urinary metabolites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Adam9 G A 8: 24,964,907 Q733* probably null Het
Adamts4 C T 1: 171,259,104 P822S probably benign Het
Arhgap9 G C 10: 127,328,465 R537P probably damaging Het
Bsn T A 9: 108,110,684 probably benign Het
Disp1 A T 1: 183,089,386 I490N probably damaging Het
Dlgap5 T G 14: 47,413,788 Y96S probably damaging Het
Dnah10 T A 5: 124,730,137 V162D possibly damaging Het
Dock7 A T 4: 99,003,886 M821K possibly damaging Het
Exoc3l T C 8: 105,290,967 R528G probably damaging Het
Fam234b G A 6: 135,209,136 G17E unknown Het
Grhl2 G A 15: 37,360,823 G617D possibly damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Hoxd9 C A 2: 74,695,687 probably benign Het
Hspa9 A G 18: 34,939,423 S550P probably damaging Het
Ide A C 19: 37,329,186 S63A unknown Het
Kat6b T A 14: 21,669,669 I1363N probably damaging Het
Ltbp1 T A 17: 75,291,367 C614* probably null Het
Mphosph8 A G 14: 56,674,465 D315G probably benign Het
Mthfr-ps1 A C 5: 78,474,483 noncoding transcript Het
Mug1 A G 6: 121,873,734 T730A probably benign Het
Myef2 T C 2: 125,115,479 T119A possibly damaging Het
Pald1 A G 10: 61,343,692 L466P probably damaging Het
Pcdh15 G A 10: 74,645,680 V286M probably damaging Het
Pcdhgb2 A G 18: 37,691,897 D647G probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Pkp4 A G 2: 59,305,162 Y126C probably damaging Het
Plppr1 A G 4: 49,300,993 I109V probably benign Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ppp2r5d G A 17: 46,687,081 Q219* probably null Het
Raf1 C T 6: 115,623,054 probably null Het
Rfx7 C T 9: 72,616,643 R372W probably damaging Het
Robo4 C A 9: 37,405,581 S397R probably benign Het
Sat1 T C X: 155,215,186 probably benign Het
Serpina1c T C 12: 103,897,080 K287R probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Ttn T A 2: 76,798,040 Y14592F probably damaging Het
Ube3b T C 5: 114,398,428 F245S possibly damaging Het
Ugt3a2 G A 15: 9,335,793 probably null Het
Wdr91 T A 6: 34,904,522 S297C possibly damaging Het
Zcwpw2 T C 9: 117,998,914 noncoding transcript Het
Other mutations in Car5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01890:Car5a APN 8 121923610 missense probably benign 0.07
IGL01972:Car5a APN 8 121927082 critical splice donor site probably null
R0152:Car5a UTSW 8 121916446 missense probably damaging 1.00
R0562:Car5a UTSW 8 121944730 missense probably benign 0.00
R0699:Car5a UTSW 8 121944816 unclassified probably benign
R1827:Car5a UTSW 8 121923808 missense probably benign 0.00
R2274:Car5a UTSW 8 121944669 critical splice donor site probably null
R5436:Car5a UTSW 8 121917242 intron probably benign
R5869:Car5a UTSW 8 121916380 missense probably benign
R5937:Car5a UTSW 8 121939821 missense probably damaging 1.00
R6388:Car5a UTSW 8 121927171 missense probably damaging 1.00
R6803:Car5a UTSW 8 121923765 critical splice donor site probably null
R7369:Car5a UTSW 8 121923834 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGGAAGCCAACCATGTTG -3'
(R):5'- CCAAAGCAGTGACCAGAGTG -3'

Sequencing Primer
(F):5'- GCCAACCATGTTGCCTCTTAAAG -3'
(R):5'- AGTGACCAGAGTGGCCTGTTC -3'
Posted On2015-06-20