Incidental Mutation 'R4261:4930407I10Rik'
ID322672
Institutional Source Beutler Lab
Gene Symbol 4930407I10Rik
Ensembl Gene ENSMUSG00000075524
Gene NameRIKEN cDNA 4930407I10 gene
SynonymsLOC328573
MMRRC Submission 041074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4261 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82059151-82066540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82063726 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 608 (D608G)
Ref Sequence ENSEMBL: ENSMUSP00000097965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100396]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100396
AA Change: D608G

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097965
Gene: ENSMUSG00000075524
AA Change: D608G

DomainStartEndE-ValueType
Pfam:DUF4727 25 234 1.1e-109 PFAM
internal_repeat_1 321 406 9.89e-8 PROSPERO
low complexity region 453 465 N/A INTRINSIC
internal_repeat_2 593 707 6.03e-6 PROSPERO
low complexity region 735 752 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
internal_repeat_2 842 958 6.03e-6 PROSPERO
internal_repeat_1 876 962 9.89e-8 PROSPERO
low complexity region 985 996 N/A INTRINSIC
low complexity region 1117 1133 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1199 1208 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1282 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Adam9 G A 8: 24,964,907 Q733* probably null Het
Adamts4 C T 1: 171,259,104 P822S probably benign Het
Arhgap9 G C 10: 127,328,465 R537P probably damaging Het
Bsn T A 9: 108,110,684 probably benign Het
Car5a A T 8: 121,944,749 H15Q probably benign Het
Disp1 A T 1: 183,089,386 I490N probably damaging Het
Dlgap5 T G 14: 47,413,788 Y96S probably damaging Het
Dnah10 T A 5: 124,730,137 V162D possibly damaging Het
Dock7 A T 4: 99,003,886 M821K possibly damaging Het
Exoc3l T C 8: 105,290,967 R528G probably damaging Het
Fam234b G A 6: 135,209,136 G17E unknown Het
Grhl2 G A 15: 37,360,823 G617D possibly damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Hoxd9 C A 2: 74,695,687 probably benign Het
Hspa9 A G 18: 34,939,423 S550P probably damaging Het
Ide A C 19: 37,329,186 S63A unknown Het
Kat6b T A 14: 21,669,669 I1363N probably damaging Het
Ltbp1 T A 17: 75,291,367 C614* probably null Het
Mphosph8 A G 14: 56,674,465 D315G probably benign Het
Mthfr-ps1 A C 5: 78,474,483 noncoding transcript Het
Mug1 A G 6: 121,873,734 T730A probably benign Het
Myef2 T C 2: 125,115,479 T119A possibly damaging Het
Pald1 A G 10: 61,343,692 L466P probably damaging Het
Pcdh15 G A 10: 74,645,680 V286M probably damaging Het
Pcdhgb2 A G 18: 37,691,897 D647G probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Pkp4 A G 2: 59,305,162 Y126C probably damaging Het
Plppr1 A G 4: 49,300,993 I109V probably benign Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ppp2r5d G A 17: 46,687,081 Q219* probably null Het
Raf1 C T 6: 115,623,054 probably null Het
Rfx7 C T 9: 72,616,643 R372W probably damaging Het
Robo4 C A 9: 37,405,581 S397R probably benign Het
Sat1 T C X: 155,215,186 probably benign Het
Serpina1c T C 12: 103,897,080 K287R probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Ttn T A 2: 76,798,040 Y14592F probably damaging Het
Ube3b T C 5: 114,398,428 F245S possibly damaging Het
Ugt3a2 G A 15: 9,335,793 probably null Het
Wdr91 T A 6: 34,904,522 S297C possibly damaging Het
Zcwpw2 T C 9: 117,998,914 noncoding transcript Het
Other mutations in 4930407I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:4930407I10Rik APN 15 82066380 missense probably benign 0.00
IGL02135:4930407I10Rik APN 15 82065004 missense possibly damaging 0.63
IGL02367:4930407I10Rik APN 15 82065547 missense probably benign 0.00
IGL02626:4930407I10Rik APN 15 82065609 missense probably damaging 0.99
IGL02885:4930407I10Rik APN 15 82063951 missense probably benign 0.36
IGL03199:4930407I10Rik APN 15 82062355 missense possibly damaging 0.65
R0062:4930407I10Rik UTSW 15 82063066 missense probably benign 0.00
R0062:4930407I10Rik UTSW 15 82066303 missense probably damaging 0.98
R0086:4930407I10Rik UTSW 15 82062601 missense probably benign 0.11
R0578:4930407I10Rik UTSW 15 82059355 missense possibly damaging 0.49
R1130:4930407I10Rik UTSW 15 82059360 missense probably benign
R1218:4930407I10Rik UTSW 15 82064152 missense probably benign 0.04
R1942:4930407I10Rik UTSW 15 82065424 missense probably damaging 0.98
R2380:4930407I10Rik UTSW 15 82064835 missense possibly damaging 0.92
R3945:4930407I10Rik UTSW 15 82065400 missense probably damaging 1.00
R4096:4930407I10Rik UTSW 15 82062205 missense probably benign 0.07
R4259:4930407I10Rik UTSW 15 82063726 missense possibly damaging 0.89
R4805:4930407I10Rik UTSW 15 82066427 nonsense probably null
R4992:4930407I10Rik UTSW 15 82064002 missense possibly damaging 0.60
R5094:4930407I10Rik UTSW 15 82062682 missense possibly damaging 0.72
R5161:4930407I10Rik UTSW 15 82063341 nonsense probably null
R5201:4930407I10Rik UTSW 15 82062544 missense probably benign 0.26
R5305:4930407I10Rik UTSW 15 82059219 missense possibly damaging 0.52
R5588:4930407I10Rik UTSW 15 82065216 missense possibly damaging 0.83
R5844:4930407I10Rik UTSW 15 82065864 missense probably benign 0.33
R6007:4930407I10Rik UTSW 15 82062739 missense probably benign 0.13
R6157:4930407I10Rik UTSW 15 82063416 missense possibly damaging 0.67
R6188:4930407I10Rik UTSW 15 82059270 missense probably benign 0.01
R6350:4930407I10Rik UTSW 15 82063563 missense possibly damaging 0.55
R6408:4930407I10Rik UTSW 15 82065106 missense possibly damaging 0.77
R6805:4930407I10Rik UTSW 15 82062543 missense possibly damaging 0.95
R6911:4930407I10Rik UTSW 15 82063867 missense probably benign 0.01
R6962:4930407I10Rik UTSW 15 82064949 missense probably benign 0.14
R7446:4930407I10Rik UTSW 15 82066240 missense probably benign
R7492:4930407I10Rik UTSW 15 82064359 missense possibly damaging 0.63
X0011:4930407I10Rik UTSW 15 82059285 missense probably damaging 1.00
X0026:4930407I10Rik UTSW 15 82063311 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGAAGTTGAACTGGGCTTG -3'
(R):5'- CCAAGTTTCTGGGTCTGTGCTC -3'

Sequencing Primer
(F):5'- GTTGAACTGGGCTTGAAGAAG -3'
(R):5'- GTGCTCCATCTGTGCCGTTAG -3'
Posted On2015-06-20