Incidental Mutation 'R4261:Sat1'
ID322685
Institutional Source Beutler Lab
Gene Symbol Sat1
Ensembl Gene ENSMUSG00000025283
Gene Namespermidine/spermine N1-acetyl transferase 1
Synonyms
MMRRC Submission 041074-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R4261 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location155213132-155216449 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 155215186 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026318] [ENSMUST00000112551] [ENSMUST00000152463]
Predicted Effect probably benign
Transcript: ENSMUST00000026318
SMART Domains Protein: ENSMUSP00000026318
Gene: ENSMUSG00000025283

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 17 144 2e-7 PFAM
Pfam:Acetyltransf_7 64 144 1.9e-9 PFAM
Pfam:Acetyltransf_1 65 146 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112551
SMART Domains Protein: ENSMUSP00000108170
Gene: ENSMUSG00000025283

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 65 153 2.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150046
Predicted Effect probably benign
Transcript: ENSMUST00000152463
SMART Domains Protein: ENSMUSP00000138776
Gene: ENSMUSG00000025283

DomainStartEndE-ValueType
SCOP:d1cjwa_ 1 64 1e-5 SMART
PDB:3BJ8|D 1 70 1e-46 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the acetyltransferase family, and is a rate-limiting enzyme in the catabolic pathway of polyamine metabolism. It catalyzes the acetylation of spermidine and spermine, and is involved in the regulation of the intracellular concentration of polyamines and their transport out of cells. Defects in this gene are associated with keratosis follicularis spinulosa decalvans (KFSD). Alternatively spliced transcripts have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, increased percent body fat and total fat pad weight, abnormal liver and white adipose tissue physiology, abnormal aerobic energy metabolism, increased serum leptin levels, and increased weight gain on a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,995,234 S298P probably damaging Het
4930407I10Rik A G 15: 82,063,726 D608G possibly damaging Het
Actr10 T C 12: 70,952,985 V185A probably benign Het
Adam9 G A 8: 24,964,907 Q733* probably null Het
Adamts4 C T 1: 171,259,104 P822S probably benign Het
Arhgap9 G C 10: 127,328,465 R537P probably damaging Het
Bsn T A 9: 108,110,684 probably benign Het
Car5a A T 8: 121,944,749 H15Q probably benign Het
Disp1 A T 1: 183,089,386 I490N probably damaging Het
Dlgap5 T G 14: 47,413,788 Y96S probably damaging Het
Dnah10 T A 5: 124,730,137 V162D possibly damaging Het
Dock7 A T 4: 99,003,886 M821K possibly damaging Het
Exoc3l T C 8: 105,290,967 R528G probably damaging Het
Fam234b G A 6: 135,209,136 G17E unknown Het
Grhl2 G A 15: 37,360,823 G617D possibly damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Hoxd9 C A 2: 74,695,687 probably benign Het
Hspa9 A G 18: 34,939,423 S550P probably damaging Het
Ide A C 19: 37,329,186 S63A unknown Het
Kat6b T A 14: 21,669,669 I1363N probably damaging Het
Ltbp1 T A 17: 75,291,367 C614* probably null Het
Mphosph8 A G 14: 56,674,465 D315G probably benign Het
Mthfr-ps1 A C 5: 78,474,483 noncoding transcript Het
Mug1 A G 6: 121,873,734 T730A probably benign Het
Myef2 T C 2: 125,115,479 T119A possibly damaging Het
Pald1 A G 10: 61,343,692 L466P probably damaging Het
Pcdh15 G A 10: 74,645,680 V286M probably damaging Het
Pcdhgb2 A G 18: 37,691,897 D647G probably damaging Het
Pdgfrb A C 18: 61,077,631 T737P probably benign Het
Pgk2 T G 17: 40,207,383 T385P probably benign Het
Pkp4 A G 2: 59,305,162 Y126C probably damaging Het
Plppr1 A G 4: 49,300,993 I109V probably benign Het
Ppcs A G 4: 119,421,909 F149L probably damaging Het
Ppp2r5d G A 17: 46,687,081 Q219* probably null Het
Raf1 C T 6: 115,623,054 probably null Het
Rfx7 C T 9: 72,616,643 R372W probably damaging Het
Robo4 C A 9: 37,405,581 S397R probably benign Het
Serpina1c T C 12: 103,897,080 K287R probably benign Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Slc38a4 A G 15: 96,998,493 Y498H probably damaging Het
Ttn T A 2: 76,798,040 Y14592F probably damaging Het
Ube3b T C 5: 114,398,428 F245S possibly damaging Het
Ugt3a2 G A 15: 9,335,793 probably null Het
Wdr91 T A 6: 34,904,522 S297C possibly damaging Het
Zcwpw2 T C 9: 117,998,914 noncoding transcript Het
Other mutations in Sat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4259:Sat1 UTSW X 155215186 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- TTTCAAATGGAGGCAAAGGTTG -3'
(R):5'- TCTGTAGAAACCCGGAAAAGTTAG -3'

Sequencing Primer
(F):5'- TTGCAAATTAGAGGCAATGGTTG -3'
(R):5'- TGTCCCAATCTTCAGGTT -3'
Posted On2015-06-20