Mutagenetix > Incidental Mutations

Incidental Mutation 'R4276:Olfr1289'

322691

Institutional Source

Beutler Lab

Gene Symbol

Olfr1289

Ensembl Gene

ENSMUSG00000061195

Gene Name

olfactory receptor 1289

Synonyms

GA_x6K02T2Q125-72534883-72535821, MOR245-6

MMRRC Submission

041647-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R4276 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111480819-111484615 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 111483504 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 25 (V25L)

Ref Sequence

ENSEMBL: ENSMUSP00000147119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102551] [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816] [ENSMUST00000217611]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102551
AA Change: V25L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099611
Gene: ENSMUSG00000108908
AA Change: V25L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	17	289	6e-45	PFAM
Pfam:7TM_GPCR_Srsx	20	288	1.4e-7	PFAM
Pfam:7tm_1	27	273	7e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000104889

SMART Domains

Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	304	1.3e-43	PFAM
Pfam:7tm_1	41	287	2.5e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120021
AA Change: V53L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000207494
AA Change: V25L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000214816

Predicted Effect

probably benign
Transcript: ENSMUST00000217611

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225425

Meta Mutation Damage Score

0.2836

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad8	C	A	9: 26,978,449	Q316H	probably null	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Brix1	T	C	15: 10,481,747	D101G	possibly damaging	Het
Cfap36	A	G	11: 29,230,584		probably null	Het
Chrnb3	A	G	8: 27,393,751	N172S	probably damaging	Het
Csnk1e	T	C	15: 79,429,767	N37S	probably damaging	Het
Ern1	T	C	11: 106,407,181	I705V	probably benign	Het
Gimap8	T	C	6: 48,659,083	M594T	probably benign	Het
Gm6578	G	A	6: 12,100,188		noncoding transcript	Het
Gpc6	A	G	14: 117,435,916	D195G	probably damaging	Het
Gpcpd1	T	C	2: 132,540,287	K412E	probably damaging	Het
Insm1	C	A	2: 146,222,968	H235N	probably benign	Het
Jmjd8	A	G	17: 25,829,813		probably benign	Het
Kbtbd8	T	C	6: 95,126,933	V521A	probably damaging	Het
Kcna5	T	C	6: 126,533,366	T600A	probably damaging	Het
Kctd6	G	C	14: 8,222,806	R216P	probably damaging	Het
Lbx1	C	A	19: 45,235,089	V47L	probably benign	Het
Mefv	A	T	16: 3,715,569	N279K	probably benign	Het
Mroh1	T	G	15: 76,393,851	V24G	probably damaging	Het
Nt5c1b	A	G	12: 10,374,886	E142G	probably damaging	Het
Olfr1038-ps	G	A	2: 86,122,279	A119T	probably damaging	Het
Padi2	A	G	4: 140,936,548	E404G	possibly damaging	Het
Pitpnb	A	G	5: 111,371,392		probably null	Het
Plxna4	T	C	6: 32,200,948	N1006S	probably benign	Het
Proc	A	G	18: 32,135,914	V6A	probably benign	Het
Prrc2c	T	A	1: 162,673,591	K1214N	probably damaging	Het
Pstpip2	A	G	18: 77,861,856	I122V	probably benign	Het
Pus10	A	G	11: 23,706,895	E207G	probably damaging	Het
Rabl2	G	A	15: 89,584,188		probably benign	Het
Rbp3	G	A	14: 33,958,650	V1070I	probably benign	Het
Rtl6	T	A	15: 84,557,196		probably benign	Het
Scn7a	T	G	2: 66,684,063	K1122N	probably damaging	Het
Spag16	A	G	1: 69,873,481		probably benign	Het
Spata13	C	T	14: 60,756,296	R396C	probably damaging	Het
Stmn4	A	T	14: 66,355,717		probably benign	Het
Syp	G	T	X: 7,638,692		probably benign	Het
Tmem260	C	T	14: 48,477,636	T249M	probably damaging	Het
Tnrc6b	A	G	15: 80,901,971	I1239V	probably benign	Het
Ubr3	C	T	2: 69,938,387	Q510*	probably null	Het
Vegfa	A	G	17: 46,031,466	V142A	probably benign	Het
Vmn2r93	T	C	17: 18,304,830	I250T	possibly damaging	Het

Other mutations in Olfr1289

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Olfr1289	APN	2	111484101	missense	probably damaging	1.00
IGL01682:Olfr1289	APN	2	111483843	missense	probably damaging	1.00
IGL02028:Olfr1289	APN	2	111483471	missense	probably benign	0.01
IGL02731:Olfr1289	APN	2	111483528	missense	probably benign	0.00
IGL03035:Olfr1289	APN	2	111483823	missense	probably benign	0.04
R1214:Olfr1289	UTSW	2	111483892	missense	probably damaging	1.00
R1471:Olfr1289	UTSW	2	111484006	missense	probably damaging	1.00
R1714:Olfr1289	UTSW	2	111483663	missense	probably damaging	1.00
R2088:Olfr1289	UTSW	2	111484278	missense	probably damaging	1.00
R2136:Olfr1289	UTSW	2	111483616	missense	probably damaging	1.00
R2141:Olfr1289	UTSW	2	111483630	missense	probably benign	0.23
R3945:Olfr1289	UTSW	2	111483687	nonsense	probably null
R4562:Olfr1289	UTSW	2	111483564	missense	probably benign	0.00
R4896:Olfr1289	UTSW	2	111483660	missense	possibly damaging	0.82
R4946:Olfr1289	UTSW	2	111483966	missense	possibly damaging	0.93
R5004:Olfr1289	UTSW	2	111483660	missense	possibly damaging	0.82
R5686:Olfr1289	UTSW	2	111484143	missense	probably damaging	1.00
R6032:Olfr1289	UTSW	2	111483850	missense	probably damaging	1.00
R6032:Olfr1289	UTSW	2	111483850	missense	probably damaging	1.00
R6960:Olfr1289	UTSW	2	111483726	missense	possibly damaging	0.70
R7293:Olfr1289	UTSW	2	111483354	splice site	probably null
R7642:Olfr1289	UTSW	2	111483478	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CAAGACCTTAATGGGTGAGCAG -3'
(R):5'- AGCCCTTAACAGAGATGACTTTG -3'

Sequencing Primer
(F):5'- CCTTAATGGGTGAGCAGAGGTAAG -3'
(R):5'- CCTTAACAGAGATGACTTTGCGTTTG -3'

Posted On

2015-06-20