Incidental Mutation 'R4276:Gpcpd1'
ID322692
Institutional Source Beutler Lab
Gene Symbol Gpcpd1
Ensembl Gene ENSMUSG00000027346
Gene Nameglycerophosphocholine phosphodiesterase 1
Synonyms2310004G06Rik, 2310032D16Rik, Prei4
MMRRC Submission 041647-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R4276 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location132529082-132587729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132540287 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 412 (K412E)
Ref Sequence ENSEMBL: ENSMUSP00000105769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028822] [ENSMUST00000060955] [ENSMUST00000110136] [ENSMUST00000110142] [ENSMUST00000145694] [ENSMUST00000148833] [ENSMUST00000149854]
Predicted Effect probably damaging
Transcript: ENSMUST00000028822
AA Change: K228E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028822
Gene: ENSMUSG00000027346
AA Change: K228E

DomainStartEndE-ValueType
Pfam:GDPD 142 432 1.3e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000060955
AA Change: K412E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062221
Gene: ENSMUSG00000027346
AA Change: K412E

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
low complexity region 142 160 N/A INTRINSIC
low complexity region 167 175 N/A INTRINSIC
Pfam:GDPD 326 615 5.3e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110136
AA Change: K228E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105763
Gene: ENSMUSG00000027346
AA Change: K228E

DomainStartEndE-ValueType
Pfam:GDPD 142 431 4.1e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110142
AA Change: K412E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105769
Gene: ENSMUSG00000027346
AA Change: K412E

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
low complexity region 142 160 N/A INTRINSIC
low complexity region 167 175 N/A INTRINSIC
Pfam:GDPD 326 615 6.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127712
Predicted Effect probably benign
Transcript: ENSMUST00000145694
SMART Domains Protein: ENSMUSP00000116457
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 110 3.78e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148833
SMART Domains Protein: ENSMUSP00000116156
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 99 1.02e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149854
SMART Domains Protein: ENSMUSP00000116949
Gene: ENSMUSG00000027346

DomainStartEndE-ValueType
CBM_2 3 94 5.54e-13 SMART
Meta Mutation Damage Score 0.1913 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 C A 9: 26,978,449 Q316H probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Brix1 T C 15: 10,481,747 D101G possibly damaging Het
Cfap36 A G 11: 29,230,584 probably null Het
Chrnb3 A G 8: 27,393,751 N172S probably damaging Het
Csnk1e T C 15: 79,429,767 N37S probably damaging Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Gimap8 T C 6: 48,659,083 M594T probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Gpc6 A G 14: 117,435,916 D195G probably damaging Het
Insm1 C A 2: 146,222,968 H235N probably benign Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Kbtbd8 T C 6: 95,126,933 V521A probably damaging Het
Kcna5 T C 6: 126,533,366 T600A probably damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lbx1 C A 19: 45,235,089 V47L probably benign Het
Mefv A T 16: 3,715,569 N279K probably benign Het
Mroh1 T G 15: 76,393,851 V24G probably damaging Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Olfr1038-ps G A 2: 86,122,279 A119T probably damaging Het
Olfr1289 G T 2: 111,483,504 V25L probably damaging Het
Padi2 A G 4: 140,936,548 E404G possibly damaging Het
Pitpnb A G 5: 111,371,392 probably null Het
Plxna4 T C 6: 32,200,948 N1006S probably benign Het
Proc A G 18: 32,135,914 V6A probably benign Het
Prrc2c T A 1: 162,673,591 K1214N probably damaging Het
Pstpip2 A G 18: 77,861,856 I122V probably benign Het
Pus10 A G 11: 23,706,895 E207G probably damaging Het
Rabl2 G A 15: 89,584,188 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rtl6 T A 15: 84,557,196 probably benign Het
Scn7a T G 2: 66,684,063 K1122N probably damaging Het
Spag16 A G 1: 69,873,481 probably benign Het
Spata13 C T 14: 60,756,296 R396C probably damaging Het
Stmn4 A T 14: 66,355,717 probably benign Het
Syp G T X: 7,638,692 probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Tnrc6b A G 15: 80,901,971 I1239V probably benign Het
Ubr3 C T 2: 69,938,387 Q510* probably null Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn2r93 T C 17: 18,304,830 I250T possibly damaging Het
Other mutations in Gpcpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Gpcpd1 APN 2 132556983 splice site probably null
IGL00672:Gpcpd1 APN 2 132530548 utr 3 prime probably benign
IGL00676:Gpcpd1 APN 2 132554011 missense probably damaging 1.00
IGL00832:Gpcpd1 APN 2 132546850 missense probably damaging 1.00
IGL00931:Gpcpd1 APN 2 132538118 missense probably benign 0.00
IGL01309:Gpcpd1 APN 2 132550324 missense probably damaging 0.97
IGL01960:Gpcpd1 APN 2 132539898 critical splice donor site probably null
IGL02110:Gpcpd1 APN 2 132530610 nonsense probably null
IGL02267:Gpcpd1 APN 2 132568710 missense probably damaging 1.00
IGL02570:Gpcpd1 APN 2 132547685 missense probably benign 0.01
IGL02588:Gpcpd1 APN 2 132534753 missense probably damaging 1.00
IGL03306:Gpcpd1 APN 2 132534073 critical splice donor site probably null
Baependi UTSW 2 132544435 missense probably damaging 1.00
R0413:Gpcpd1 UTSW 2 132564623 splice site probably benign
R1876:Gpcpd1 UTSW 2 132534753 missense probably damaging 1.00
R4571:Gpcpd1 UTSW 2 132550350 missense probably benign 0.05
R4849:Gpcpd1 UTSW 2 132534099 missense probably damaging 1.00
R4930:Gpcpd1 UTSW 2 132546874 missense probably damaging 1.00
R5060:Gpcpd1 UTSW 2 132544435 missense probably damaging 1.00
R5081:Gpcpd1 UTSW 2 132547702 missense probably benign 0.17
R5148:Gpcpd1 UTSW 2 132534190 nonsense probably null
R5189:Gpcpd1 UTSW 2 132553972 missense probably damaging 1.00
R5344:Gpcpd1 UTSW 2 132558677 intron probably benign
R5623:Gpcpd1 UTSW 2 132534717 missense probably damaging 1.00
R6086:Gpcpd1 UTSW 2 132538114 missense probably damaging 1.00
R6787:Gpcpd1 UTSW 2 132537838 intron probably benign
R6885:Gpcpd1 UTSW 2 132554074 missense possibly damaging 0.56
R7223:Gpcpd1 UTSW 2 132534056 missense probably benign 0.00
R7261:Gpcpd1 UTSW 2 132568699 missense probably damaging 0.97
R7900:Gpcpd1 UTSW 2 132534739 missense probably damaging 0.99
R8120:Gpcpd1 UTSW 2 132554023 missense probably damaging 1.00
R8494:Gpcpd1 UTSW 2 132544435 missense probably damaging 0.97
X0018:Gpcpd1 UTSW 2 132534769 missense probably damaging 1.00
X0060:Gpcpd1 UTSW 2 132534781 missense probably damaging 1.00
X0066:Gpcpd1 UTSW 2 132544395 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTAGCAAGCTAGAACAGACAATGTG -3'
(R):5'- AGCTCTCTCATCTTCAGTAAGTTG -3'

Sequencing Primer
(F):5'- GCTAGAACAGACAATGTGAAATTACC -3'
(R):5'- CATCTTCAGTAAGTTGAGAAGGTAGG -3'
Posted On2015-06-20