Incidental Mutation 'R4276:Insm1'
ID322693
Institutional Source Beutler Lab
Gene Symbol Insm1
Ensembl Gene ENSMUSG00000068154
Gene Nameinsulinoma-associated 1
SynonymsIA-1
MMRRC Submission 041647-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4276 (G1)
Quality Score184
Status Validated
Chromosome2
Chromosomal Location146221921-146225020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 146222968 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 235 (H235N)
Ref Sequence ENSEMBL: ENSMUSP00000092048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089257]
Predicted Effect probably benign
Transcript: ENSMUST00000089257
AA Change: H235N

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000092048
Gene: ENSMUSG00000068154
AA Change: H235N

DomainStartEndE-ValueType
low complexity region 41 88 N/A INTRINSIC
low complexity region 137 164 N/A INTRINSIC
low complexity region 190 230 N/A INTRINSIC
ZnF_C2H2 272 292 1.49e2 SMART
ZnF_C2H2 300 322 3.78e-1 SMART
low complexity region 324 348 N/A INTRINSIC
low complexity region 358 371 N/A INTRINSIC
ZnF_C2H2 373 395 4.4e-2 SMART
ZnF_C2H2 452 475 2.09e-3 SMART
ZnF_C2H2 480 503 1.18e-2 SMART
Meta Mutation Damage Score 0.0617 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Insulinoma-associated 1 (INSM1) gene is intronless and encodes a protein containing both a zinc finger DNA-binding domain and a putative prohormone domain. This gene is a sensitive marker for neuroendocrine differentiation of human lung tumors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display perinatal and neonatal lethality, respiratory failure, and impaired pancreatic and intestinal endocrine cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 C A 9: 26,978,449 Q316H probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Brix1 T C 15: 10,481,747 D101G possibly damaging Het
Cfap36 A G 11: 29,230,584 probably null Het
Chrnb3 A G 8: 27,393,751 N172S probably damaging Het
Csnk1e T C 15: 79,429,767 N37S probably damaging Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Gimap8 T C 6: 48,659,083 M594T probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Gpc6 A G 14: 117,435,916 D195G probably damaging Het
Gpcpd1 T C 2: 132,540,287 K412E probably damaging Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Kbtbd8 T C 6: 95,126,933 V521A probably damaging Het
Kcna5 T C 6: 126,533,366 T600A probably damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lbx1 C A 19: 45,235,089 V47L probably benign Het
Mefv A T 16: 3,715,569 N279K probably benign Het
Mroh1 T G 15: 76,393,851 V24G probably damaging Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Olfr1038-ps G A 2: 86,122,279 A119T probably damaging Het
Olfr1289 G T 2: 111,483,504 V25L probably damaging Het
Padi2 A G 4: 140,936,548 E404G possibly damaging Het
Pitpnb A G 5: 111,371,392 probably null Het
Plxna4 T C 6: 32,200,948 N1006S probably benign Het
Proc A G 18: 32,135,914 V6A probably benign Het
Prrc2c T A 1: 162,673,591 K1214N probably damaging Het
Pstpip2 A G 18: 77,861,856 I122V probably benign Het
Pus10 A G 11: 23,706,895 E207G probably damaging Het
Rabl2 G A 15: 89,584,188 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rtl6 T A 15: 84,557,196 probably benign Het
Scn7a T G 2: 66,684,063 K1122N probably damaging Het
Spag16 A G 1: 69,873,481 probably benign Het
Spata13 C T 14: 60,756,296 R396C probably damaging Het
Stmn4 A T 14: 66,355,717 probably benign Het
Syp G T X: 7,638,692 probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Tnrc6b A G 15: 80,901,971 I1239V probably benign Het
Ubr3 C T 2: 69,938,387 Q510* probably null Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn2r93 T C 17: 18,304,830 I250T possibly damaging Het
Other mutations in Insm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4737:Insm1 UTSW 2 146222902 missense probably benign
R6766:Insm1 UTSW 2 146223426 nonsense probably null
R7237:Insm1 UTSW 2 146222528 missense possibly damaging 0.79
R7408:Insm1 UTSW 2 146222791 missense probably benign 0.01
R7486:Insm1 UTSW 2 146223818 missense probably damaging 1.00
R7634:Insm1 UTSW 2 146223107 missense probably damaging 1.00
Z1176:Insm1 UTSW 2 146223556 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGATGGGCACTGCGTTCTC -3'
(R):5'- AACTTCTTGGCGCAGTGGTG -3'

Sequencing Primer
(F):5'- ACCGGTCCTCCACTGTcc -3'
(R):5'- TGAAGACCTTGGCGCACTCTG -3'
Posted On2015-06-20