Mutagenetix > Incidental Mutations

Incidental Mutation 'R4276:Gimap8'

322698

Institutional Source

Beutler Lab

Gene Symbol

Gimap8

Ensembl Gene

ENSMUSG00000064262

Gene Name

GTPase, IMAP family member 8

Synonyms

IAN9, LOC243374

MMRRC Submission

041647-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4276 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48647234-48660875 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 48659083 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 594 (M594T)

Ref Sequence

ENSEMBL: ENSMUSP00000145255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078223] [ENSMUST00000203083] [ENSMUST00000203509]

Predicted Effect

probably benign
Transcript: ENSMUST00000078223

SMART Domains

Protein: ENSMUSP00000077350
Gene: ENSMUSG00000064262

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:AIG1	49	251	1.5e-55	PFAM
Pfam:MMR_HSR1	50	173	4.7e-7	PFAM
Pfam:AIG1	285	473	7.7e-51	PFAM
Pfam:AIG1	476	682	4.2e-67	PFAM
Pfam:MMR_HSR1	477	603	3e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203083
AA Change: M594T

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000145286
Gene: ENSMUSG00000064262
AA Change: M594T

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:AIG1	49	251	1.5e-55	PFAM
Pfam:MMR_HSR1	50	173	4.7e-7	PFAM
Pfam:AIG1	285	473	7.7e-51	PFAM
Pfam:AIG1	476	682	4.2e-67	PFAM
Pfam:MMR_HSR1	477	603	3e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203509
AA Change: M594T

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000145255
Gene: ENSMUSG00000064262
AA Change: M594T

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:AIG1	49	251	1.5e-55	PFAM
Pfam:MMR_HSR1	50	173	4.7e-7	PFAM
Pfam:AIG1	285	473	7.7e-51	PFAM
Pfam:AIG1	476	682	4.2e-67	PFAM
Pfam:MMR_HSR1	477	603	3e-7	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. The encoded protein is larger than the other gene family members and includes three AIG1 domains (corresponding to the AIG1 protein from Arabidopsis thaliana) whereas other family members have one AIG1 domain. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad8	C	A	9: 26,978,449	Q316H	probably null	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Brix1	T	C	15: 10,481,747	D101G	possibly damaging	Het
Cfap36	A	G	11: 29,230,584		probably null	Het
Chrnb3	A	G	8: 27,393,751	N172S	probably damaging	Het
Csnk1e	T	C	15: 79,429,767	N37S	probably damaging	Het
Ern1	T	C	11: 106,407,181	I705V	probably benign	Het
Gm6578	G	A	6: 12,100,188		noncoding transcript	Het
Gpc6	A	G	14: 117,435,916	D195G	probably damaging	Het
Gpcpd1	T	C	2: 132,540,287	K412E	probably damaging	Het
Insm1	C	A	2: 146,222,968	H235N	probably benign	Het
Jmjd8	A	G	17: 25,829,813		probably benign	Het
Kbtbd8	T	C	6: 95,126,933	V521A	probably damaging	Het
Kcna5	T	C	6: 126,533,366	T600A	probably damaging	Het
Kctd6	G	C	14: 8,222,806	R216P	probably damaging	Het
Lbx1	C	A	19: 45,235,089	V47L	probably benign	Het
Mefv	A	T	16: 3,715,569	N279K	probably benign	Het
Mroh1	T	G	15: 76,393,851	V24G	probably damaging	Het
Nt5c1b	A	G	12: 10,374,886	E142G	probably damaging	Het
Olfr1038-ps	G	A	2: 86,122,279	A119T	probably damaging	Het
Olfr1289	G	T	2: 111,483,504	V25L	probably damaging	Het
Padi2	A	G	4: 140,936,548	E404G	possibly damaging	Het
Pitpnb	A	G	5: 111,371,392		probably null	Het
Plxna4	T	C	6: 32,200,948	N1006S	probably benign	Het
Proc	A	G	18: 32,135,914	V6A	probably benign	Het
Prrc2c	T	A	1: 162,673,591	K1214N	probably damaging	Het
Pstpip2	A	G	18: 77,861,856	I122V	probably benign	Het
Pus10	A	G	11: 23,706,895	E207G	probably damaging	Het
Rabl2	G	A	15: 89,584,188		probably benign	Het
Rbp3	G	A	14: 33,958,650	V1070I	probably benign	Het
Rtl6	T	A	15: 84,557,196		probably benign	Het
Scn7a	T	G	2: 66,684,063	K1122N	probably damaging	Het
Spag16	A	G	1: 69,873,481		probably benign	Het
Spata13	C	T	14: 60,756,296	R396C	probably damaging	Het
Stmn4	A	T	14: 66,355,717		probably benign	Het
Syp	G	T	X: 7,638,692		probably benign	Het
Tmem260	C	T	14: 48,477,636	T249M	probably damaging	Het
Tnrc6b	A	G	15: 80,901,971	I1239V	probably benign	Het
Ubr3	C	T	2: 69,938,387	Q510*	probably null	Het
Vegfa	A	G	17: 46,031,466	V142A	probably benign	Het
Vmn2r93	T	C	17: 18,304,830	I250T	possibly damaging	Het

Other mutations in Gimap8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01341:Gimap8	APN	6	48658767	missense	probably damaging	1.00
IGL02830:Gimap8	APN	6	48656305	missense	probably benign	0.01
Kangchenjunga	UTSW	6	48659163	missense	probably damaging	1.00
lhotse	UTSW	6	48658954	missense	possibly damaging	0.74
R1224:Gimap8	UTSW	6	48650695	missense	probably benign	0.04
R1386:Gimap8	UTSW	6	48656653	missense	probably benign	0.04
R1503:Gimap8	UTSW	6	48647529	critical splice donor site	probably null
R1560:Gimap8	UTSW	6	48656134	missense	probably damaging	1.00
R1681:Gimap8	UTSW	6	48656411	missense	probably benign	0.01
R2012:Gimap8	UTSW	6	48656353	missense	probably damaging	0.98
R2094:Gimap8	UTSW	6	48650568	missense	probably benign	0.00
R2937:Gimap8	UTSW	6	48658796	missense	possibly damaging	0.55
R2938:Gimap8	UTSW	6	48658796	missense	possibly damaging	0.55
R3147:Gimap8	UTSW	6	48650506	missense	probably damaging	1.00
R4281:Gimap8	UTSW	6	48658820	missense	probably benign	0.37
R4294:Gimap8	UTSW	6	48658957	missense	probably benign	0.00
R4713:Gimap8	UTSW	6	48658986	missense	probably benign	0.23
R4750:Gimap8	UTSW	6	48650427	missense	probably benign	0.01
R4896:Gimap8	UTSW	6	48659347	missense	possibly damaging	0.85
R4936:Gimap8	UTSW	6	48656134	missense	probably damaging	1.00
R5041:Gimap8	UTSW	6	48659163	missense	probably damaging	1.00
R5091:Gimap8	UTSW	6	48656647	missense	possibly damaging	0.91
R5215:Gimap8	UTSW	6	48651083	missense	possibly damaging	0.88
R5360:Gimap8	UTSW	6	48656302	missense	probably damaging	1.00
R6119:Gimap8	UTSW	6	48658954	missense	possibly damaging	0.74
R6221:Gimap8	UTSW	6	48658942	missense	probably damaging	1.00
R6450:Gimap8	UTSW	6	48656451	missense	probably benign	0.03
R7137:Gimap8	UTSW	6	48650253	missense	probably damaging	0.99
R7154:Gimap8	UTSW	6	48656188	missense	probably damaging	1.00
R7666:Gimap8	UTSW	6	48659155	missense	probably damaging	1.00
R7686:Gimap8	UTSW	6	48656072	missense	probably damaging	0.99
R7912:Gimap8	UTSW	6	48651065	missense	probably benign	0.09
R7993:Gimap8	UTSW	6	48651065	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CTGGCACTGAAAAGGATCCC -3'
(R):5'- CACCCATGAATTTGAATGCTCATC -3'

Sequencing Primer
(F):5'- AGGATCCCTCCAGGTTAAAGG -3'
(R):5'- TCAACAGACCTTTCACCTGGG -3'

Posted On

2015-06-20