Incidental Mutation 'R4276:Kbtbd8'
ID322699
Institutional Source Beutler Lab
Gene Symbol Kbtbd8
Ensembl Gene ENSMUSG00000030031
Gene Namekelch repeat and BTB (POZ) domain containing 8
SynonymsSSEC 51, SSEC51, Takrp, SSEC-51
MMRRC Submission 041647-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R4276 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location95117240-95129790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95126933 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 521 (V521A)
Ref Sequence ENSEMBL: ENSMUSP00000113739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032107] [ENSMUST00000119582]
Predicted Effect probably damaging
Transcript: ENSMUST00000032107
AA Change: V598A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032107
Gene: ENSMUSG00000030031
AA Change: V598A

DomainStartEndE-ValueType
BTB 49 147 7.37e-28 SMART
BACK 152 254 1.37e-26 SMART
Kelch 334 388 2.63e-3 SMART
Kelch 389 439 6.13e-4 SMART
Kelch 480 530 5.06e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119582
AA Change: V521A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113739
Gene: ENSMUSG00000030031
AA Change: V521A

DomainStartEndE-ValueType
Pfam:BTB 1 70 5.1e-14 PFAM
BACK 75 177 1.37e-26 SMART
Kelch 257 311 2.63e-3 SMART
Kelch 312 362 6.13e-4 SMART
Blast:Kelch 364 402 4e-18 BLAST
Kelch 403 453 5.06e0 SMART
Meta Mutation Damage Score 0.2573 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 C A 9: 26,978,449 Q316H probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Brix1 T C 15: 10,481,747 D101G possibly damaging Het
Cfap36 A G 11: 29,230,584 probably null Het
Chrnb3 A G 8: 27,393,751 N172S probably damaging Het
Csnk1e T C 15: 79,429,767 N37S probably damaging Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Gimap8 T C 6: 48,659,083 M594T probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Gpc6 A G 14: 117,435,916 D195G probably damaging Het
Gpcpd1 T C 2: 132,540,287 K412E probably damaging Het
Insm1 C A 2: 146,222,968 H235N probably benign Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Kcna5 T C 6: 126,533,366 T600A probably damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lbx1 C A 19: 45,235,089 V47L probably benign Het
Mefv A T 16: 3,715,569 N279K probably benign Het
Mroh1 T G 15: 76,393,851 V24G probably damaging Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Olfr1038-ps G A 2: 86,122,279 A119T probably damaging Het
Olfr1289 G T 2: 111,483,504 V25L probably damaging Het
Padi2 A G 4: 140,936,548 E404G possibly damaging Het
Pitpnb A G 5: 111,371,392 probably null Het
Plxna4 T C 6: 32,200,948 N1006S probably benign Het
Proc A G 18: 32,135,914 V6A probably benign Het
Prrc2c T A 1: 162,673,591 K1214N probably damaging Het
Pstpip2 A G 18: 77,861,856 I122V probably benign Het
Pus10 A G 11: 23,706,895 E207G probably damaging Het
Rabl2 G A 15: 89,584,188 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rtl6 T A 15: 84,557,196 probably benign Het
Scn7a T G 2: 66,684,063 K1122N probably damaging Het
Spag16 A G 1: 69,873,481 probably benign Het
Spata13 C T 14: 60,756,296 R396C probably damaging Het
Stmn4 A T 14: 66,355,717 probably benign Het
Syp G T X: 7,638,692 probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Tnrc6b A G 15: 80,901,971 I1239V probably benign Het
Ubr3 C T 2: 69,938,387 Q510* probably null Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn2r93 T C 17: 18,304,830 I250T possibly damaging Het
Other mutations in Kbtbd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Kbtbd8 APN 6 95126513 missense probably damaging 1.00
IGL01382:Kbtbd8 APN 6 95122230 missense probably damaging 1.00
IGL01459:Kbtbd8 APN 6 95122808 missense probably benign 0.10
IGL01656:Kbtbd8 APN 6 95118676 missense probably benign 0.02
IGL02100:Kbtbd8 APN 6 95122682 missense probably damaging 1.00
IGL02133:Kbtbd8 APN 6 95121732 splice site probably benign
IGL02532:Kbtbd8 APN 6 95126536 missense probably benign 0.17
IGL02982:Kbtbd8 APN 6 95126566 missense probably benign 0.01
IGL03074:Kbtbd8 APN 6 95122352 missense probably damaging 0.99
R0782:Kbtbd8 UTSW 6 95122232 missense probably damaging 1.00
R2075:Kbtbd8 UTSW 6 95126683 missense possibly damaging 0.47
R2329:Kbtbd8 UTSW 6 95126780 missense probably benign 0.00
R2698:Kbtbd8 UTSW 6 95126589 nonsense probably null
R3906:Kbtbd8 UTSW 6 95126584 missense probably damaging 1.00
R4915:Kbtbd8 UTSW 6 95126534 missense possibly damaging 0.95
R5141:Kbtbd8 UTSW 6 95121839 missense probably damaging 1.00
R5294:Kbtbd8 UTSW 6 95121832 nonsense probably null
R5779:Kbtbd8 UTSW 6 95118534 missense probably benign
R6645:Kbtbd8 UTSW 6 95126749 nonsense probably null
R7073:Kbtbd8 UTSW 6 95121833 missense probably damaging 1.00
R7161:Kbtbd8 UTSW 6 95126696 missense probably benign 0.30
R7600:Kbtbd8 UTSW 6 95122592 missense probably damaging 1.00
R7731:Kbtbd8 UTSW 6 95118578 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGAGCTACTCAAGTGACTG -3'
(R):5'- AAATGCTGATAACCGCACTTTG -3'

Sequencing Primer
(F):5'- GCTACTCAAGTGACTGTTGAAG -3'
(R):5'- CCTTTCCTGACTGAACTGAAAATATC -3'
Posted On2015-06-20