Incidental Mutation 'R4276:Kcna5'
ID322700
Institutional Source Beutler Lab
Gene Symbol Kcna5
Ensembl Gene ENSMUSG00000045534
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 5
SynonymsKv1.5
MMRRC Submission 041647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4276 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126532551-126535412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126533366 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 600 (T600A)
Ref Sequence ENSEMBL: ENSMUSP00000055673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060972]
Predicted Effect probably damaging
Transcript: ENSMUST00000060972
AA Change: T600A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055673
Gene: ENSMUSG00000045534
AA Change: T600A

DomainStartEndE-ValueType
low complexity region 65 80 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
BTB 111 211 5e-7 SMART
Pfam:Ion_trans 240 516 6.6e-54 PFAM
Pfam:Ion_trans_2 424 509 1.4e-15 PFAM
Meta Mutation Damage Score 0.3494 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ino channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, the function of which could restore the resting membrane potential of beta cells after depolarization and thereby contribute to the regulation of insulin secretion. This gene is intronless, and the gene is clustered with genes KCNA1 and KCNA6 on chromosome 12. Defects in this gene are a cause of familial atrial fibrillation type 7 (ATFB7). [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal microglial proliferation and nitric oxide release after LPS treatment or facial nerve lesion. Mice homozygous for a knock-in allele exhibit impaired hypoxic pulmonary vasoconstriction, and resistance to drug-induced cardiac QT prolongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 C A 9: 26,978,449 Q316H probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Brix1 T C 15: 10,481,747 D101G possibly damaging Het
Cfap36 A G 11: 29,230,584 probably null Het
Chrnb3 A G 8: 27,393,751 N172S probably damaging Het
Csnk1e T C 15: 79,429,767 N37S probably damaging Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Gimap8 T C 6: 48,659,083 M594T probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Gpc6 A G 14: 117,435,916 D195G probably damaging Het
Gpcpd1 T C 2: 132,540,287 K412E probably damaging Het
Insm1 C A 2: 146,222,968 H235N probably benign Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Kbtbd8 T C 6: 95,126,933 V521A probably damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lbx1 C A 19: 45,235,089 V47L probably benign Het
Mefv A T 16: 3,715,569 N279K probably benign Het
Mroh1 T G 15: 76,393,851 V24G probably damaging Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Olfr1038-ps G A 2: 86,122,279 A119T probably damaging Het
Olfr1289 G T 2: 111,483,504 V25L probably damaging Het
Padi2 A G 4: 140,936,548 E404G possibly damaging Het
Pitpnb A G 5: 111,371,392 probably null Het
Plxna4 T C 6: 32,200,948 N1006S probably benign Het
Proc A G 18: 32,135,914 V6A probably benign Het
Prrc2c T A 1: 162,673,591 K1214N probably damaging Het
Pstpip2 A G 18: 77,861,856 I122V probably benign Het
Pus10 A G 11: 23,706,895 E207G probably damaging Het
Rabl2 G A 15: 89,584,188 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rtl6 T A 15: 84,557,196 probably benign Het
Scn7a T G 2: 66,684,063 K1122N probably damaging Het
Spag16 A G 1: 69,873,481 probably benign Het
Spata13 C T 14: 60,756,296 R396C probably damaging Het
Stmn4 A T 14: 66,355,717 probably benign Het
Syp G T X: 7,638,692 probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Tnrc6b A G 15: 80,901,971 I1239V probably benign Het
Ubr3 C T 2: 69,938,387 Q510* probably null Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn2r93 T C 17: 18,304,830 I250T possibly damaging Het
Other mutations in Kcna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Kcna5 APN 6 126534509 missense probably damaging 1.00
H8562:Kcna5 UTSW 6 126533423 missense probably damaging 0.98
R0137:Kcna5 UTSW 6 126533383 missense probably damaging 1.00
R0881:Kcna5 UTSW 6 126534994 missense probably benign
R1436:Kcna5 UTSW 6 126534761 missense probably damaging 0.99
R1561:Kcna5 UTSW 6 126534583 missense probably damaging 1.00
R1730:Kcna5 UTSW 6 126533860 missense probably damaging 1.00
R1783:Kcna5 UTSW 6 126533860 missense probably damaging 1.00
R3940:Kcna5 UTSW 6 126533651 missense probably damaging 1.00
R4372:Kcna5 UTSW 6 126533357 makesense probably null
R4562:Kcna5 UTSW 6 126534340 missense probably benign 0.00
R5130:Kcna5 UTSW 6 126534533 missense probably benign 0.01
R5137:Kcna5 UTSW 6 126533983 missense probably damaging 1.00
R5388:Kcna5 UTSW 6 126534896 missense probably benign 0.04
R5890:Kcna5 UTSW 6 126534736 missense probably damaging 1.00
R7159:Kcna5 UTSW 6 126533629 missense probably damaging 1.00
R7162:Kcna5 UTSW 6 126533843 missense possibly damaging 0.87
R7322:Kcna5 UTSW 6 126533791 missense possibly damaging 0.83
R7353:Kcna5 UTSW 6 126534845 missense probably benign 0.00
R7695:Kcna5 UTSW 6 126534211 missense probably damaging 1.00
R7775:Kcna5 UTSW 6 126534805 nonsense probably null
R7778:Kcna5 UTSW 6 126534805 nonsense probably null
R7894:Kcna5 UTSW 6 126535048 missense probably damaging 0.96
R7905:Kcna5 UTSW 6 126534868 missense probably benign
R7961:Kcna5 UTSW 6 126533554 missense probably benign
R8009:Kcna5 UTSW 6 126533554 missense probably benign
R8388:Kcna5 UTSW 6 126534625 missense probably benign 0.08
Z1176:Kcna5 UTSW 6 126533716 missense probably damaging 1.00
Z1177:Kcna5 UTSW 6 126533990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCCTTGGTGTTATGGAAAGG -3'
(R):5'- ATCATCGGGAGACAGACCAC -3'

Sequencing Primer
(F):5'- GGATGGGGAAGTTAGAGGGC -3'
(R):5'- TCTGGGCTGGACACAGGAG -3'
Posted On2015-06-20