Incidental Mutation 'R4276:Chrnb3'
ID322702
Institutional Source Beutler Lab
Gene Symbol Chrnb3
Ensembl Gene ENSMUSG00000031492
Gene Namecholinergic receptor, nicotinic, beta polypeptide 3
SynonymsAcrb3, 5730417K16Rik
MMRRC Submission 041647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4276 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location27368711-27399730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27393751 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 172 (N172S)
Ref Sequence ENSEMBL: ENSMUSP00000147672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060943] [ENSMUST00000079463] [ENSMUST00000211104]
Predicted Effect probably damaging
Transcript: ENSMUST00000060943
AA Change: N172S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052297
Gene: ENSMUSG00000031492
AA Change: N172S

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 35 239 2.3e-75 PFAM
Pfam:Neur_chan_memb 246 452 1.9e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079463
AA Change: N157S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078428
Gene: ENSMUSG00000031492
AA Change: N157S

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 35 224 1.3e-57 PFAM
Pfam:Neur_chan_memb 231 374 4.3e-48 PFAM
Pfam:Neur_chan_memb 349 437 9.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211104
AA Change: N172S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2174 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are (hetero)pentamers composed of homologous subunits. The subunits that make up the muscle and neuronal forms of nAChRs are encoded by separate genes and have different primary structure. There are several subtypes of neuronal nAChRs that vary based on which homologous subunits are arranged around the central channel. They are classified as alpha-subunits if, like muscle alpha-1 (MIM 100690), they have a pair of adjacent cysteines as part of the presumed acetylcholine binding site. Subunits lacking these cysteine residues are classified as beta-subunits (Groot Kormelink and Luyten, 1997 [PubMed 9009220]). Elliott et al. (1996) [PubMed 8906617] stated that the proposed structure for each subunit is a conserved N-terminal extracellular domain followed by 3 conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region.[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display hyperactivity and reflex abnormalities but were otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 C A 9: 26,978,449 Q316H probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Brix1 T C 15: 10,481,747 D101G possibly damaging Het
Cfap36 A G 11: 29,230,584 probably null Het
Csnk1e T C 15: 79,429,767 N37S probably damaging Het
Ern1 T C 11: 106,407,181 I705V probably benign Het
Gimap8 T C 6: 48,659,083 M594T probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Gpc6 A G 14: 117,435,916 D195G probably damaging Het
Gpcpd1 T C 2: 132,540,287 K412E probably damaging Het
Insm1 C A 2: 146,222,968 H235N probably benign Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Kbtbd8 T C 6: 95,126,933 V521A probably damaging Het
Kcna5 T C 6: 126,533,366 T600A probably damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lbx1 C A 19: 45,235,089 V47L probably benign Het
Mefv A T 16: 3,715,569 N279K probably benign Het
Mroh1 T G 15: 76,393,851 V24G probably damaging Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Olfr1038-ps G A 2: 86,122,279 A119T probably damaging Het
Olfr1289 G T 2: 111,483,504 V25L probably damaging Het
Padi2 A G 4: 140,936,548 E404G possibly damaging Het
Pitpnb A G 5: 111,371,392 probably null Het
Plxna4 T C 6: 32,200,948 N1006S probably benign Het
Proc A G 18: 32,135,914 V6A probably benign Het
Prrc2c T A 1: 162,673,591 K1214N probably damaging Het
Pstpip2 A G 18: 77,861,856 I122V probably benign Het
Pus10 A G 11: 23,706,895 E207G probably damaging Het
Rabl2 G A 15: 89,584,188 probably benign Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rtl6 T A 15: 84,557,196 probably benign Het
Scn7a T G 2: 66,684,063 K1122N probably damaging Het
Spag16 A G 1: 69,873,481 probably benign Het
Spata13 C T 14: 60,756,296 R396C probably damaging Het
Stmn4 A T 14: 66,355,717 probably benign Het
Syp G T X: 7,638,692 probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Tnrc6b A G 15: 80,901,971 I1239V probably benign Het
Ubr3 C T 2: 69,938,387 Q510* probably null Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn2r93 T C 17: 18,304,830 I250T possibly damaging Het
Other mutations in Chrnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chrnb3 APN 8 27385101 missense probably benign 0.13
IGL01655:Chrnb3 APN 8 27394174 missense probably damaging 1.00
IGL02124:Chrnb3 APN 8 27396804 unclassified probably benign
IGL02403:Chrnb3 APN 8 27393808 missense probably damaging 1.00
IGL02474:Chrnb3 APN 8 27393369 missense probably damaging 1.00
IGL02903:Chrnb3 APN 8 27386806 missense probably damaging 0.96
R0178:Chrnb3 UTSW 8 27393364 missense probably damaging 1.00
R0736:Chrnb3 UTSW 8 27385050 missense probably benign 0.00
R1695:Chrnb3 UTSW 8 27393700 missense probably damaging 1.00
R2051:Chrnb3 UTSW 8 27386811 missense probably damaging 1.00
R2091:Chrnb3 UTSW 8 27394234 missense probably damaging 1.00
R2313:Chrnb3 UTSW 8 27393781 missense probably damaging 1.00
R3020:Chrnb3 UTSW 8 27396784 missense probably benign
R3981:Chrnb3 UTSW 8 27394006 missense probably damaging 1.00
R4236:Chrnb3 UTSW 8 27393993 missense probably damaging 1.00
R4422:Chrnb3 UTSW 8 27396733 missense possibly damaging 0.84
R4515:Chrnb3 UTSW 8 27385090 missense probably damaging 1.00
R4688:Chrnb3 UTSW 8 27394119 missense probably damaging 1.00
R4931:Chrnb3 UTSW 8 27394230 missense probably damaging 0.99
R5164:Chrnb3 UTSW 8 27394132 missense probably damaging 1.00
R6333:Chrnb3 UTSW 8 27393327 missense probably damaging 0.96
R6454:Chrnb3 UTSW 8 27393375 missense probably damaging 1.00
R7070:Chrnb3 UTSW 8 27393961 missense probably damaging 1.00
R8060:Chrnb3 UTSW 8 27394560 missense unknown
R8156:Chrnb3 UTSW 8 27393654 missense probably benign 0.13
R8421:Chrnb3 UTSW 8 27396690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATTCACTAACGGGTAAC -3'
(R):5'- TAGAACACCAGGACCGTGAG -3'

Sequencing Primer
(F):5'- GGTAACCACTTTCATGGCAGTGC -3'
(R):5'- TAAAACAGGGGCAGGCGTCTC -3'
Posted On2015-06-20